Description :
From Genome Similarity Track
Location :
Scaffold_25:1149427- 1152621
Sequence
3194 bases(100 bases per row)
TACCGCTTGAGTCGCCCGACGTAAAACGTCGGGTGGAGTCTAAGTGACGCCGGAATGTCCAGCGTGTAGGCGTCGCCCACAGCCTTGGTTACTCGAAAAG
GACCGATGAAGCGTGGAGCAAGTTTGTTGGCGCCAAGGTTGGTTACGGCAGAAGCTCGGATTCCCTCGGTCGATAGAAGAACGCGATCTCCTATCTTGAA
TACATTCACGTTCTTTCGACCATGCTTATCAGCTTGTTCCTTTTGCTTGTCCACTGCATTCTGTAGTGCGTCGCGGACGAACCTTGAGATGGATTGCCTT
TGCATGACGAATTCCGCAACTGCCGAGCGACTCCGGGCGAGGGAGCACCGAGGGTTTCGGTGTATAATTGGCCGTGGTAACTGCCTGCTCGCGAATTTTG
CTGCCTGGATCGATCAAGTTCTGCGACGTCCATCTCGTTATCGGAGATGCAGTACGCCGAGGAGGCTCGATGGGCTGCTTGGACGGAGAGCGAGTCAAGG
CGTTCACACTGGCTACACCCGAAGATAATCCTGAAGTCGAGTGCGCCGGCAGGCCTGTTGGCACCAATAAGGCTACCGGTGCGTGCTGAGACACCGGTTC
ACGTACCGGTGATGACCACAACACGGACTCGTTGTCCGCAGGACCGACCGCAAGCTCAGCGTCCATGTCGACCGAAGGAGGTTCTCCCCCACCAAGGGTG
GAGCCGCCAGCATCTGTGGGATGACCCACGGCGAGAAGTGCCGGAACACGTGGATGGCGAGCGTTGTTCCCGAAGAACGGCGTCATACCCGTCGAGGAGT
GCTCGGCGTTGTTGAGTGCGAATTCGGCTAGCGGTAGGAACGAGCTCCAGCTCGTGTACGAAGTTGCATAGCTGCGGAGAACGTCTTCAAGGACGCTGTT
GACGCGTTCTTTTTGTCCATCCGTCTCCGGATGTGCCGCAGTCGACATCAGCAATTTGTTTCCCAAGAGCTCGAAGAGGCGTGACCAGAACGCGGATGTA
AACCGCGGGTCGCGGTCGGACACGATGGACTCCGGCAGACCGTGGTGACGAAAAATCACGTCGACGAAGTGGGCCGCGGACTCTTCCGCGGTGATTGAGG
CTGCCACCGGAACGAGATGGACCATCTTGCTGAAACAAACGACGAACACAAGTACACCCGTGCGCCCGGCTGTATCGGGCGAAAGACCGAAGATGAAGTC
CATCGAAATGGAGCGCCAGGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGGGTCTGAGACGTCGAAGACGGTTTGACTCGCTGGCAAGTTTCACATGTG
CGGACCCACTTGCGTACCCACTTGTACATGTGCGGCCAGTAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTCGGGG
CGTCATGATACTCGTGGATTATGCGCGCACGTAGATCAGCGTCGTTTGGGACGATGACTCGAGGTCCATCGAACCTGTCGATGCTGTACTTGAGCAGATT
GCCGTCCAGTCGATATCGATCGATCTGATTCCGCGTGGTCTTTGACAGGGCACTTAGCGCGTCACTACTAGGAGCACGCAGGTGTTTCATGATGGCACCG
TATATAGGGTCATCATCGTACGCTGTAGCAATCTCGTCACCCAGCGGGAGCGTGGGCGTGGTCAACGTCAAGTTGATGCCTGACGACACGCAGACCGCAC
ATTCGTCGTCGTCCTCATCAGCCAGCTGATGTCCTAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGAAAGCGCGTCGGCGAGAATGTTATTCTTGCC
CGGCTTGTAGTGAGCAACGAAGTTGTACTCGAAGAAGAAGGACAGTCAACGGGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGAT
GCGTGATCAGTGTAAACCGCAAACGACTGTTCACCGAGCAAGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTG
GGTATTCTTCTCGGCTGGCTTCAGTTGGCGCGACTGATAGCTGATAACGCGTTCGTGCTCGTCGTCATCGAACTGCATCAGCGCACAGCGATGGCAAAAT
CACTCGCGTCGCAGACGACGTGGAATGGCTTTGAGTCATCAGCAAGCTTCAGGATCGACGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTG
GTGGTTCGATTTTCACTCCCAGATCACGTCTTTCTTCAGCAGCGAGGACAGCGGCTGGATCAACCCAGCGTATTTTTCGTGTACTTGTGCAAGTAATTGG
CCATGCCAAGCCACTGACGCAACTCAGTGGGGCTTGTCGGCGTTGGACAAGTACAGATAGACGATACCTTCTCGGGATCCGCGCGCACACCGTTCTTGCT
CACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTC
AGGTGTTTCAGATGTACTTCCACGGCACTGAGGTTGCCCTCAGCGCGGCTATGCACGAAGATGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGCGGAC
GAAGCACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGTTCTTGAGACCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTAC
GGCGGTGAGAGGCACATCAGATGCTCTCATCAGGATCTGATAGAATCCATCGGTCAGGTCAATGGCGCTGTAGATGACGCTACCAGCCAATGGAGTCCAG
TATTATGTTCTTCCGAGGGATCGGAGTCTGCGCGGGGATGGTGGCATCATTCAACTTGTTGAATGCGTGAACAATACGCCATCCCCCTGTAGCTTTCTTC
ACACAGAACGTTGGACTGGAATGGGGAGAGGTACTCTCACGCACGTGACCCGCCTTTCGGCGGCCCTCGAAGAAGTCATCGATCGCTTTCACTTGATCAC
GAGGAAGTGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCATGCTGAACCCCACGATCCGCCGGTAGCTCGGCGGGGATCTC
ATCCGGGAATACGTCGGCGTACTCGCAGGCGGTGTCGTATACGGATTCGCCGACTCCCGCAAGGCCTCCCAAGACTGCGTTTGGAATCGTTCCT