Description :
From Genome Similarity Track
Location :
Scaffold_210:11492- 13728
Transcript NameFunction/comments
Phypl_g5304hypothetical protein

Sequence
2236 bases(100 bases per row)
CATTTGGGCGGCGACTGGAGCGAGATGAACCATCTTGCTGAAGCgatcgacgaagacgaggacgccagTGCGTCCCTGATCGTCGCACGGAAGACTGAAG
ACGATGTCCATGCTGACGGATCCCCACGTACTCGTGGCGATGGGCAACGGACGCAGTGGAGCTTGCTTCGATGCCGATTGCTTGATGCGCTAGCAGGTCT
CGCAAGAGCGAACCCACTTGCGTACCCATTTGTACATGCGGGTccagaagaagtcgcgcgAAAGTGCCTCGAACGTCTTCTCGCGACCAAGATGTCCACC
GGGACGATCGTCTTGGTACCCGTGAACCAGACGAGCGCGAAGGTCGTCATCGGCGGGGATGACGGCGCGCGGGGAGTCGAACGTGTCGATGGCGTACGTG
AGCAGGTCGCCGTCCAGGTCGTAACGCGTGATGTACTCACGCGTTGGACGCGTCAGCTTGGACAGCGTCTCCGCCAACAGATCGCGGAGATGTCGGAGGA
TCGCGGCGTAGAGGACGTCTTCCTCGTACGCCTCTGCAATCTGCTGACGCAGCGGAAGAACGGGGGTTGACAACATGGCGTTGATGCCCAGTGCCTCGCA
GACAGCAcagttgtcgtcgtcgtcatcagGAAGGTCCTGAGGTCCCGTCAAACGTCTCGGGTCGTAGTCCGGACGCCGAGAGAGTGCGTCAGCGAGAATG
TTGTTCTTGCCGGGCTTGTAATGAACGACGAAGTTGAACTCCGCGACGAAAGAGAGCCACCGCGCCATGCGCCGAGAGAGATGTGGACTCTTCATCGCCG
TACGAAGCGAAGAGTGATCCATGTACACCGTGAACGTCTGCTTCCCGAGTAGATATACGCTGAATTTGATCAGAGCGTAGCGCATCGCGAGATGTTCCTT
GTCGTGCACGGGGTAATTCTTTTTCGCCGGCTTCATCTGTAGTGATTGATAACTCACGACGCGTTCGTGACCCGCATCGTCGAATTGCATGAGCGCACAC
CCGATGGCGAAGCCACTCGCGTCACAGAGGACATGAAAGGGTCTTGACGTATCGTGAAGCATCAAGACGGGTGCGGACGCATGACTCTCTTTCACGGACT
CGAACACGTCCGGGTGCTCAGGACGCCAGTTCCATGTCACATCCTTCGTCAGCAAAGATGAGAGGGCTGGATCAGACCAGTATAGTCCTTGGTGTAATTG
TTGAGATAGTTCGCGAGCCGGAGCCATTGACGCAGCTCCGTTGTGTTCTTGGGAATAGGCCAAGAACAGATCGATGAGATCTTCGCTGGGTCGGCGCGGA
CGCCGCTCTTGCTGACGTAGCAGCCGAGCTCCGGAATCTCCGGTGCGCAGAACACACACTTCTTGAAGTTGGCGTACAGCTTGTTGTCGCGCATCTTCTG
GAACACCTGGTGCAGGTGTTGTCGATGGACGTCGACAACACTAATGCCATCCTCAGCGCGGCTGCGCACGAAGATATTGTCGAAATAGCTCGGCGCGAAT
TTGAGGAGCGGGCGCAGTACATGGGAGATCATGCGATTAAACGTGGCAGGAGCGTTCTTCAAGCCCTGTGGTATGACGATCCACTCCCAGAGCATTCCGC
TGGGAGTGCTAACAGCGGTCAGCGAAACGTACTTTCGCCCATGAGGATCTGATAGAAGCCATCCATCAGATCGATCGCGCTGTAGACGACGCTGCCAGAC
ATGGAGTTTAGCACCATGTATTTCCGAGGAACCGGAGTCTGCGCTGGGATGGTGGCATCACTCAGCTTGTTGAACGCGTGAACCTCCggtggccttcttc
acgcaaAACGTCCGGCTCGAGTGTGGGGATGTGCTCCCACGTACGTGTACAGCCTTGTGGCGGCcctcgaagaagtcgtcgatggcTTGAACCTggtctc
gcagcagcgaccactGCCGCGGCACGCAGTATTTCGATCCAGACAcgatgtcgatctcgtcgctcgGAGGGGAGTTCCGCTGGAATCTTGTATGGGAAGA
TGTATTCTTACTCACGAGCAAGCGGATACACTGGGTTTCTGGAGTCTGGGAGCGCTGTCCAAGACTGCGCGACGAAGCGTTCCTCACGGGCTGACTTGAC
TTCAGTCGCCTTCggacgcgacgacgacgcgtcgtcgctgacAGCGTTGACGCCGACGGCAGGAGGGTCGGAACTCGTGAGGAGGCAtagctgctcgatc
tcgccgGCCTTCAAGTCACGAAGGAAATGCTTCCAG