Description :
From Genome Similarity Track
Location :
Scaffold_3491:1149- 3180
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3491-fgenesh-gene-0.0Myosin

Sequence
2031 bases(100 bases per row)
GACCATGGAGCGGCCAATGACCGGGAGCTCGGCCTCTTTCTTCAGCGTACAGTTGCTGCAGACAACCTCACCGCACTGTGATCATCAAGAAGGAAAGTGT
GAGTACATTGGTCCTGGTCCTTTCCAGCACGTAGAGAAAGAAACGGACCTTGCGGCAGTGGTGCTTTCGCCGAAAGTGCGTAAAGTTGCGCGTGCACACG
TGGCAGCGGTATCGCTCCGTGTCGAGCACCCAGTCGTCCTGGTGGCGCAGCTGGTCGATCGTGAGCACGTCGTTGCCGCCCATGCGGCTTCCCTTGACGC
CGCGGCGCGACATGCTTCTGGTGGGTTGGCCAGAGGACATCGTAAGAGACACGATAAGACGGATTAAAACCTAGTTCTTCCTCGGCGCTGGCGACGGGCG
TGCTGGCGCTGGCGCTGGAGATGGCGCGGCCACTTACAGTCTCTCTGTGCTAGCAGGCTTGGTCTTGGCGGAGGATGTGGGGATCCGAGCGCAGGATAGC
CGAGTGGCGGAGCGGAGCGGACGGAGTCTGCGATTCCAGACAGACACTGCGACCGACGGGTGGCTTGGTCTTCTCTCCGGGGAAGCAAACAAAGGGGAGA
GCCACTGGCAGGTCCACCGTCCAAAATGCCGAGTGCTTCGAGAGACTGGGGCTCGAAGGAAGGAAGGAGGGGGAGAGGGAGCGAGGGAGGGGGAGGGAGG
GGCCACAAACAGACGACGGCCCCACCCGACGGTGCTGAAACTCTGAAACTCGCTCAACTCACACTCGGACGAAAAACCCAGTTTCATCCCGTACACCAAC
AAGACGAGAGACTCGCATTTTGAGAGAGAGAGTGCGAAACAGCCGTTTTAGGGTCGGCGTCGTCCCATCGTCTGACGTGTGTTGCGGCATCGAAGAGCGT
CAGAGAAGAGCCAGAGCGGACTTGGCTCCACGCAAAACAACAACAACAGTGCCCAGCCAACAACGCAAACTTCCCGAGAAGCCACTGCGGCCACTCGCTC
CGATTTACTGCACAGTCGCTCCGGTATTCCATCCACAGTTGTCCGACATCCAAAATCGGAGCGACGGTGCGCATCGGACAACTCCATTAAATTAGCCCAT
TGTACCATAAATATTGTAATGTGACTCCTCAAAGGTTTAGGGTAAGAAATGTTATGGGTTAGGTGAACAAAGAGGTCATATCTCCCTTCTGTCATTTCAC
GTCAGATATCGGTCTGTGAGGTGAGGCGACAACTTTGTGTCTGTAAGTGCACACTCGCACAGTGCATATTACCCGAACCCTAGTCGAAGCTGCACACGAA
AACGGGTTCCGGTTAAAGACATTATTGTAAACAGGGTTTTGAGGTATGCAATCCTGTTCTCTGGCGTGTTGTCACTTTGCGGACGCCACGATTCCACTTT
CAATTGAACAGTTCACACCATCCTTCACTTCTTCTTTACCTCTTATATAGCATAGTTTCGAGAATAAAAGATGTGCAATACACGTTAGACTTGGTTGTGG
AACAGCATAGACTGTGAATATTGATCAATCGTAGCTGAGGTTGGATGCGCTTGAAAATTGAATCACATGAGCTGACACCTTGCAATACTGTGGCAAATCG
GCTGGCTTACGCACGCAGTATGATGTCAAGGGCCCATTCATGAGCCAGCTGNNNNNNNNNNACCGGCTTACGCACGCAGTCTGATGTCATGGGCCCATTC
ATGAGCCAGCTGATGTCGCGTGATGGCCATCATGACTCCGGCGCTGTCCGGAAGGTAACGTCTGCTCTTGCATTGGATGAGGCCACAAAAATTAGAAACG
AGATCCAGTGGACGGGGCGTTTTTGGGTTCCGCGGATGGCGGCCAGTGCTGCACTGGTGAGTTATTTATTGTACACTGCGCATACGAGCGTGAGCGTGTT
TCTATATTCACGAGCATTTTGCGAGCATTCTGCCTGCGCTGAGCCTCGAACGGTGGCGCTGATCGATGGTCGAGCAGAGGCTCAAGGTCCGTTCGTTTAT
CCGGCGTGATGACGCGTGCGTTCGGAGACTC