Description :
From Genome Similarity Track
Location :
Scaffold_775:11486- 16020
Transcript NameFunction/comments
Phyta_totarag10668hypothetical protein

Sequence
4534 bases(100 bases per row)
GCGCCTACGGCGCCAAGGAAGGCTCCCAAACCGCAACCACTCATGGTGAGCGTCAAAGGCTTCAAAGGAAAGGAAGGGGACAATCTCCTATTATGGACCC
GCGAGGTCGCAATGGCTATGAATTCAACCATGCTCCGaactgagcagcagcacgtggcGCTGCCAATCTCTAAGCTTGGTGGAATGGCACGAGAGTGGGC
ACTCACGTGCAGGGCGGCTGGCAATACCGCTTTCCCAATCTAGGAAGAGCTGAGACGTCAGCTGGCGAGAGTATTTTCTCTACCTAACCACGCTTACCGC
GTGCGCTCTCGCCTCCTGTCCTGCCGTCAAAGCAAAAAAGGAGTTGGTAGACTATGTCCAAGAGCTACGCACACTCATTGCTGGCATGTTTGCCGACCCT
CGGCCTGAGGTAGTCACTGCGACAGTGTTTATGGACGGTCTCAGGACCGGGTTGGCTCGAACGGAAGTATTCCGAGTCCATCCATCTTCGTTTGAAGAGG
CCGTCGCGGTGGCGTTGAATGCCGCACACAACTTCAAGTCGGCCCGACTAGGTTGGAGTGCACCGCACCGAACCCCATCGGATGGTCTGGAACCCATGGA
CGTCAGCTACGCTGAAGCTGATCTTCTAGCTGCCGAGCAGTGTATGAACATTCGGTGATGCCTTACTAGTGGCAGTACTCGCCACTTACGCATGGGGTGC
CCCTGCGCAAACAGCGCCAGACTCAGCAGATCCAAAGCTCCGATTCCAACGAGAGCTCTGGTTCGTCGCGGGGGAATCGGCGAGTCCCAGTAGGCGCGAG
GCGGCCTAGTGGGGAAGCACTGAGTTCTGTTGCATCTCGAGGAGGTATAGGTCGACAGAGCCCCCCGAAGGGATCCGAACTCTCTAACACGTACCGTGTA
TGTAATCTGGGCTGCCGGTCGTACAGGCGACCGTAAAGAGCCATGGACAGTTCGTATTGACTCCGGGGCGTCGGGCAATTACGCTCGACGCTCCACGATG
GAGGGAAACCATCTGTATGATGAAACGCTGGTAGCGCAAAGGAGTGACAGCGTCTACGTTCTACGTTCGACGAGAACCCGTGTCACGATGCCTAAGGTCG
CAATGGACATGGGCGTGAAGATCCTGgacttcgacagcatggGGCGCTGTCTGGTCCTAGACCTGGATTCGAGGCACGGCCTCATCCTTGGCATGGCATG
GCTCGAACGCCAAGGGCCATGGGTCGACTGGAGGTCGAAAACATTAGGTTCTCTACACTTCTCGCCTGATGGAGCATTGGCGAGTCATGAACCCACCTCT
ACtaggaagaagaagcgctaTTGGCGCGAGCGCTGGGCCGCGTCGGCCATGGTGTTGGACATCGGTGTGTCCGAGTTGATGGACAACGCTGTTGTTGGGG
ATGGATATCCCGAACACGACTCGGCGAGTCTGTCGTCGAGGGGTCCTGAGCAATGCTCACTGGTCCGACGTGGAACGGCACGTACTCCGTTGAGTGGTGA
GAGGTTGCCGGACGCACCACTGAGTGCTCACGTAAGCGCTGTCGACAGTGACTTTGAAAACACAGGTCCCAACGGGGCCGGAGGTGCTTTTACACCTGGA
CGGTGTGACACTGATGTCGCTACGTCACCCTCTTCCACCCGGTCTTGTGcgcggaggaggaggagctgcatagcgtctgcgacgtcgtcggcgtcggacG
AAGTGTCCAGCGTGTCGAGCAGCAATGCTCCACGCGACTGCAGCGATAAGTTGTACACACTCGTGAATGCAGTGACGGGGgaaggcgatggcgacaTCGG
CCTTGAGTCTTTCCCCACTATTGAAGctcttctcgagctggacgaaATGTccgtcgccgagttcggtGAGGCCTTGAAGGTGGGCGATTTTGCCGAAGTG
GTCATGATACGACCTAAAGAGGAATTAAACTCCTCATCCCTTGTGAATTAGGCTGTCCTTGAGGCCACCTAGAAGGCGCTCAATGCGACAAGCGGATTCA
ATATCCTTAAGGATCCCTCGGATCCGTTCTACCCGTTGCTGGTAGAGTATTGAGACGTCGTCTCGAAGTACCCACCTATGGGTCTGCCTCCGGATCGAGG
ACTTCGTCACAAGATTGACTTGGTTCCGGGAACCAAATACTGCGTGACGAGGCAGTGGCCTCTGCCAAGAGAACAGTGCGGCATCATTGACACGTTCTTC
CCTGCAAAGCATGAGGCTGGTCTGGTGGGTGAGCGTAAGTCTCCACACTCTACAACGACATTCTGTGTCAGAAATCCCAAACGGCAAGTGGCGCATCGCG
CATACTTTCAACAAGCTAAATGCAGCCACCTTTCCGGCGCAGACGCCAATTCCTCGGAAGGATGTTCTCCAGAACAACATGGTCGGCTGTACGCTGTACA
GcgccttcgacttggtcgtTGGTTACTACCAGTTGCTCATGCGAGTGAGTGACATTCCACTGACAGCCGTCAGCACTCCGAGCAGCACGCTCTGGGGTGT
GGCTGGGGATGCCTCAAAGGCTGTCGAACGCGCCAGCGACGTTCAATCGTCTAGTGACGCAGTTGTTCCTGCCTCATCGGGCGTACGCACAGACGTACTT
TGATGACATATTTGTCCACAGACGTGCAGAGCACGGGAAGTCAGGTGTGGAGAACTACATAGACCATCTacgagcagtgctcgagtGCATGTGCATCAGC
AAGTTGTATGCCAACGCTGACAAATGTGTCTTCGGCGCGGAAGAAATTCTGGATCTTTGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGATCCCGCCA
AGGTTAAAGCCATTGTAGACTGGCCGGTTCCAAAGAACCAAAAGGAATGGGTTGGGCCTCGCCAATTACTTGCACAAGTACAGCCTGAATTATGCTGATA
TGGCCAGGCCATTGTCAAATCTCCTTATAAGAAGGAGGCTGAGTGGTGTTGGGACACCGAGCAACATGGAGCCTTTGAGGCAATTAAGGAGAGCCTCCTC
CAGGCACCGATCCTGGCGCTCCTGGACCCGGACTGTCTGTTCAGTGTTGTGTGTGGCGCGTCCGGCTTTGCTATTGGATGCGCTTTACTCCAGGCGGACG
CCGAAGGGCGCCAACGCGTGATCGCGTTTGTGctcaaggctgctgagaaaAACTACCCTGTTCACGACAAAGAGCTATTTGCCATGAATCGTCAAGTTCA
GGGCCCACCTGCTCGGCTCCAAGTCTTTCGTTATTTACACGGACCATGCGTCATTACGCACTGCGATCCGGTCGCCTCACCTCTCTCAGAGAATGGATCG
ATGTTTACCCTTCTTTGCGGAGTAAAACTTCGAGATGAAGTATAAGCCGGGCAAGCAGAATGTCCTGGCCGATCCGTTATCACGCAGACCGGATTACGAG
TTTGCTCATGTCACGACTGTGACATCGTCCGTGACGGACCTGATTCGTGGAGCCTACGCACGCGACGAAACTTGTGTAGCCCTGCTACGTGTCGCGGGAG
CAAGGAATTCCCCGATTCggacacgaagatgtcgGCGCGTTCTCGCGCGAGGATACATCGATATACTCTCGCTGGGGGATTGCTGTATTACATCACAGGC
TCGGATGATACGTCACGCGTGGTAGTTCCTCATAACGAGGACTTGAAGTATCGCATCCTCTATGAGGCCCATGATACCCCACTCGATGGACACCTGCGTC
GCGAGAAGACGTAGAGCGCTGTCAACGCGACGTACTGGTGGCCGAAGCTGTACAAATGGGACAGCAAATACATGCGCACGTGTGAGGCGTGTCAACGGGT
GAAGCCCTCGCCGCATTGGCTGCGCCTTTGGCGAGTTTGCCTGTCCCTACGGGATGTTGACAGTCCATGAGCATGGACTTTGCGTTTGGCCTGCCGATGG
ACTCGGCGGGCAACACGGGCATTATGGTCTTTGTGGACCGACTGAGCAAGATGGCTCCCTTGGCAGCAGTGTCAGACTCTATGGACGGGGAGGGTACAGC
TAAGTTGTTTCTCGACCGTGTTTTTCAACAACATGGTCTCCTCGAGACGATCGTCTCGGACCGAGCCCTGCCTTACGGGAAAGTATTGGAAGTCCGTCTT
CGATGGGCTAGACACTCGCTTGGACATGTTCACGGCGGATCATCCGCAGACGACGGTCAGACTGAGCGCGTTAATCGCGTTGTCGAGGACGTCCTCCGTA
GCGTGTGCGCTGAGACGCCGATGTGTTGAAGCGCCATGCTCCAACTCGTTGAGTTTGCATTGAATGATGCGGTGCACGCCTCGACAGGCTTCATCCCGTT
CTATGCCAACGGCTTGGCCCACCCTAGTGTTCCACTAACACCGCCACGCAGTGGCCTTGGGCTATGTGGGGGAGGAGAAGCCGACTGGCTAGCTGATGTC
AGCCCTTCTGCTGTGCGTAAGCAGGTTCATGACTTCTTGTCAACGCGTCTCAATGTCCTTCGACATGTGCGTGACGCAATGGCTGAAAGCCAAGGTGTTC
AAACGAAACAAGCGGATGCGAAAGGCAGGGGCAA