Description :
From Genome Similarity Track
Location :
Scaffold_67:114859- 118184
Sequence
3325 bases(100 bases per row)
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
AATGCTGCACGGTACCGGCTCAGACGCCGATACCGAGGAAGGACGTGATCATAGATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGA
TGGCTCCTATCAGATCCTAATGCGTGAAAGGGACATCCCGTACACAGCAGTGAGCACCCCCAGCGGTATGCTGTAGTAGTGGCTAGTGATGCCACAGGGG
CTGAGTAACGCCCCTGCAACGTTCAACAGATGTGCAACAAATCTGTTGAGACCGGTGCGGGACTTCGCACCGAGTTACTTTGACGATGTGTGCGTCCATA
GCCGGGATATGGATGGGAAGACGGACGTGGAAGTTTACAGAACACACGTTCGTCAGGTTCTTCAACTTATGAGGAAGCATTAGTTGTATGCCAACCTCAA
GAAGTGTATATTCGCGGCTAGCGATTTACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCCATCAAGGCGATCACCGACTGGCCT
GTGACAGTCGATGTCAAGGGACTAAAAAAGTTCCTTGAGCTAGCGGCGTACTTGCACAAGTACTCGCGCAATTACGCCGAGATGACTGTGCATATTTCTT
GTTTACTCAAGAAAAATGTGAAGTGGTCATGGAACGATGACTGTCAGAGTTCCTTTGAACGTATCAAGCAGAGCTTGATGCAGTCGCCCATACTGGCGAT
TGCAGATCAGGACAGACCATTCCACGTGGTCTGTGAAGCCAGCGATTTTGCAATCGGCTGTGCGTTGATGCAATTTGATAGAGATGGCGCAGAGCGCGTC
ATCTGCTATCAATCGCGTCAGCTGCAAGCAGCTGATCGTAATTACCCAGTGCATGACAAGGAACACCTTGCCACGAAATATGTACTGGCTAAGTCTCGTG
TCTATCTCTTGGGAGATAGACCGTTCATCGTCTATACGGACCATGCGTCACTATGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGAATGGTGAGGTG
GCTTTCCTTTTTCGCGGAGTACAACTTCTCCGTCGAGTACAAACCAGGACGACTGAATGTCGTCGCTGATGCGCTTTCGCGGCGACCCGATTTCGAGCCG
GGCGCGCAATCCAACAATGAGGAGAATCCCACTGTTGCGACACTTACAATCAGTGTCCCGTCGTCAACGTTACTTGACGAAGTAAGAAAGGCCTACGCAG
ATAAGGATTTTCTGCAATTGATGGATTAACTGGTAAATCCAACTCGTAAATCGTTGCAAGATTTATCGGCTTTATACCGTTCCTCATCAGATCGGTACAC
AATACGCAACGGGTTGCTGTACTATACAGCCGTTGTCAGCGACACGCCTCGTGTCGCCGTCCCCGCTCATAACGATTTGCGCGTGCGCATAATGTATGAG
TGTCACGATGCCCCAACAAGTGGCCATCGTGGTAGAGAAAAGACTTACTTTAAGGTAGATCGTGACTTTACTGGCCCCGCCAGTATTAGTTTGTACGCAA
GTACATTCGTGCTTGCGAGGTTTGTCAACGGGTGAAGCCTAGTCCTTCATCCCGTGCATCCTAACAGCCTCTACCTATCTCGGCAGAGTGCTGGCAGTCC
GTTTTTCTGGACTTCGTCTTCAGTTTCCCCCGAAGACGCTCACAAGAATACTGGTATTCTTGTGTTTTGGACCGGTTCAGCAAGATGGTGCATCTTGCTG
CTATACCCGAGTCGATCACGGCACAGGGCTGTGCTCGTGTCTGCATCGACACAATCTTTCGACTCCACGGGTTACCCTGTGAACTCGTATCCGACCGTGA
TCCTTGGTTCACGGCGGAGTTTTGGCAACCCGTGTTCCGGTCACTCGGAACGCGATTGAAGATGTCAACATCTGACCATCTCGAGACAGATGGTCAGACA
GAACGTGAAAACCGTGTCCTCGAAGAGATACTTCGAGGATGCGTCTACTCGTTCTCGAGTTGGAGCGTATTCCTCCCCATGGTGGAATTCGCGATCAATA
ATTCGGTGCATGCGTCAACCCAGCACACACCATTCTTCGTGAATGACTTACGCCAGCCGCGTCTGCCCACCCTATTAGAGTGTGGCTCTTGGTTAAGGGG
GGGAAGGGACTCGCTCGAGCAAAAA