Description :
From Genome Similarity Track
Location :
contig_57:114810- 116342
Transcript NameFunction/comments
g10493.t1hypothetical protein

Sequence
1532 bases(100 bases per row)
GTGACACTAATTTTCGACCGAGACCTAAATCGAAAAATATGGAAATTAGTGTCCGTCGCGCTAATTTTCGACAGACTCTAATAACCCTGATAAGGAAATA
GTGTCGAGGACAGTATTTTCCGACAACAAGAAATTAGTGTCCAATCAGCGACAGGGATGTGACGTTGGTGCAGCTTAGTGGTTGAGCGCTCGTTTACCAA
ACGAGAGGTCGATGGTTCGATTCCATCCACCAACATTTGATTCGGATCATGATGCGGATCATACTGGGGTTTCTTGTTCACATCGAGAGCCGGCGCACAG
AACTGCTAACGCGACCGCCGTCCGGCATTTCGTGTGAACAGGTTGACCGCCAGTATGCTAAGCACCATGAGTCGGGCGCCCCTTCTGACGAAGATTCGAT
GCTCGTTCTGATATCTCAGAACACTGCGTCTACAATCGGAAGTCACAGCGGCCCCAGGCATACAGAGGGATATCGTATCACAACTCCAAGACTAGGATGT
AAGCAAGAATGAAATTTTATGAAGTTGATGGAAAGTTGTCCTTTCTTGCGAACTCATCGGGGTACTCCTTGATGATTTCTTGAAGGTGGGGGTACAGCTG
TGCCACAGTCCAACTCCCATCAACGTCTCGGGACATACCGCAGCGAATCATAGCCTTCCGAGCATACGTCAGCCCGTTCTTGTCTCTGAGGGTGTTGAGC
TCTTGCACACACTCAGCGGCCAGCTTCAAGAAGAAAGGCTTCCCTGGGTTCTTCAACTTACCTGACCACGCACTATCGTTGCGCACTTTGTCCTGCCAAT
CCCCGTCCATGATCAGCTCGAGCTTCTTGGCATTCCACTTTCGCGCCCAGATCGATTTCAGCTTGGCGATGACGAACGAATCCGCTGGCTGACAGAGGTC
AGTGGAGTTGGGTGGCAAAAAGTGCAGATCCGCATTGAGGATTCGCAGCTCTTCAGCGCATTCGTCTGCTGACAGGTGCCCTCCACAGTTGTCGAGAAAG
ATCGCCTTTTTCTTTCCGTGAGGATCGGCACGGATGGCTCGACGTTCGAGCAAAAACTGACGAAACACACGCTTGTCCATCCACCCTTTCGGTCCGGTGC
GGTAACACACGCCTTGAACATCGTCTGGGACGCCTCGTATTGGATAGTTGGCACTGGCGTTCTGTAGAATCATCATCGGTGGCATGACACGACCGCTGGC
GCCACCGGTAAGTCTGACGACCATCGTCATTCCTTCGCCCCCTGAAACGACTTCTGCATACTTAATGGAAGTCTCGCCCACGAAGCCAAGCGTTTTTCCG
GTGTCGAAGTCGATCACAAAGTGGGTCTCGTCTATGTTTTCGATGGTGTCTTCGTCTAGGTCGCCACTGAGGAAGCCATGCTGTAGACGACCGAGGTGCC
TCGCCACGGATGCTCGGATTTCTTTTGTCTTTCTCCGATACTTGTTTCTTCCCCGTTTGTGACCTGAGTACAATACCGTGTTTTTCCATAAAATACTGGA
TCCAAGAGTTTGTCAGCCTCTCGATGATCGTC