Description :
From Genome Similarity Track
Location :
Scaffold_1736:1148- 3882
Sequence
2734 bases(100 bases per row)
TGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACC
TACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGC
CCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGG
AAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCTAAAGCTAGTGCATCTAGAGCTGCGCAGACCATTGCTGAATCGTACGAG
GAGTGCGATTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGAGGGCCAGGCTTTATGTCTGATTTCTTTTGAGCATTCAACCGGATCCTGG
TGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCA
GGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTG
GTACATGGGTGGGATCCCAAATCCACCCTAGAAGTGGCCATTCCGGTATGTAGCACCATGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCC
AGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCT
AATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGATACGCCCGAAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGC
GAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAAT
ACCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAATCCTCCTACCGGAAGATAGTTGGAATATGGATCTCGA
AGACGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGACGAATTTACCGCGAATTTCTAGTGTATTGGCGTGGA
TATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGA
TGCAGTCTCATGAAGAAGAGTAGGAAGGGGATCCGTTGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGG
AGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGGATCCACAGGGGAAGGGTGGATTAAAAGGAAGGAGTGAATGTTTATGG
ATAAGCGTGACGTTTTACGTGCGAAGAGTCCCGCTTGATCTCAAGCGCGAGCTTTTAAGGGCCCGAGCTATACTGACCCAATTGAAACTGGGTCATTGGC
GCTAGATTCGGATGAAATCCAGGCGCGGATCCAACCGGATCCGGGTGTACATTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGA
TCCCGCCCAGATCCAGGTGTACACTGAAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACACTGA
AAGGCTCTGACTAGATTTCGCAACCAACGAGGGAATGTTATAGACATATTCAAGTAAGAGAATGTGGATTATAATGGCTTATGCAAAGGGCTAACTCGAC
CCAGTTTCCAGTCGCTAGTTACTGCTACGAAACGAATCCACGAAGACTGAAACTAGGGGCGTGGCGTCAAAGAGTGATGAGGATCAGGTAGTCTTGGGCT
GAACGTTGAAGAACTTGCCCACTAGACGCTTGATCTGGCGTCCTGGGTGTTGGCTCAGGTCCCCGCGAAACTGGATGCGCCAAGGCTCGGCTTCGTCGAT
CTCTCGCAAAGCTTCCAATAGGCTCGTGGGTTCGGGGCGATGGAGGTTGGGATACTCCAAGTTGGCTTGACGGGATACGGATCCCGTAAACCAAGCTACC
TTATCCCCGCGTCGGGGAAGATGCAAGAAGGATGGATCCAACAAAATATCCACGTCACACCAACCATCCTGGATTGCCAACACGAGGATCACAAGGACTC
TCTTCCAAGCTCGACCAGCATGGCTACGTCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAAGTCGAACCCTGCAGTTGGTTCCGAGAGATGGGGAA
CCGGTGAGTGGCCTCCCATATGGCAACCCGGTGCTTGGAGACGAAATCCCGGAACGCACGAACGAATACCCCGAGTCGCCCACGCACATCACCCCTGAAG
CTAACCGGATGCACCGGTGTGGTGGCCAGCGTATCCCACGGGGCAGCACTTATCAGCTCTTCCACGAGAGGTCTGGTGATGAGCGAATCCACGTACCCGG
CCTCGGGATGGCGTCTGCTGTCCGAGGAAATATC