Description :
From Genome Similarity Track
Location :
Scaffold_2907:1148- 2394
Sequence
1246 bases(100 bases per row)
TCGCACCTCTGGACATGCTTGACTACATCAACGTACAAGCCAACCCAGTAGAATTCGGCTTTCACCCTATGGAAGGACCGTACAATGCCTTGGTGTCCGC
CCTCGATCGAATTGTGGCAGCTCTGGAGTACTTCGTCGATCATGGTGGTCGGAACTACTAGTCTTAACGTCAGGTCATCACCATTGGACTCAGCTCGGTT
TCTTCGTTGTCCCAAGTAGTACAAGAGTCCGTCCTCGCTGAGTACGAAGTTATCGGCAATTTTGCTTGCATTCTGTGTCCGTCGGTGTGTAAGACCGTCG
AGTTCGCCTTGGAGTACTGCTTTCACGTCTGCCCACTTTGCTTCTTCCGACTGAGCTCTAGATATACGTCTTCGTCTTTCAGCCTGGACGACCACTGGGT
CTATGTCAGCTGAGTTGGACAGTCGATTCTCGTCCACTTCTATCTGAGCTTGTCCTTCCACTCGGCGCATTGGTAGATTCCGTCTCATTGACTCACAAGA
GCTGGTTTCCGATGTTGGACTCGGCTCTGGACCCTGAGATCCTTGAGCTGAGTCATGTGGCATTTCATCCTCAAAGTGGACTCGGCGGGTTTGATTCCTC
GTCATGACTGCCATCTCAGCTGAGTCTTTATAGTGGTCCGCTGAGTTCTTTTCCACATATAGGACTTCTGCGATCCTGTTTAGAGTTTTGAGCTCAGCTT
TGCGGGCTTCGTTGAGAACTACCCGGCCAGCTTTATTCTCCAATGCTTCAGTAGCGAGGGAGTCGGCTGCCGCATTATAGTATCGCACTACATGCAGGTA
GTGAATTGAACTCAGCTTTCCAGTCAGGTCTTTATGGCGCGCAAATTCAACTTGCAACGATTCCTTCTTAGATGCGATCACCCCCATGGATTGCTGGATT
GCAAGCCTGGAGTCACCAACAATTATTAAGTCAGTCACCCCACGGGTGATGGCGACCTGGACGCCGTTATTCATACCGGCGTACTCGGCTGTGTTGACTG
TGGTCGACGAAAGGTGCGCACTCGCAGCGATCTCAATGTTCCAACTTGGCAAGCTCCACAGTATCCACGAACAGCTTCCGTAACCTCCATACTTCTCAGT
TTTAGCAGATCCATCAAAAGACAGCAAATATCCTTCGAAGTCGCGCTGGACATGAACATACAGGAGTTCGGGGTTGAACCGGACCGTCACcgagttcttc
gacggcggAGCGATATGCGCTAACGACGCTTCGAATCCAATACAAT