Description :
From Genome Similarity Track
Location :
Scaffold_936:1148- 2390
Transcript NameFunction/comments
Phyag_g8777conserved hypothetical protein

Sequence
1242 bases(100 bases per row)
TCGCGCTGGCGGCTATTCATGGTGGCCGTCATGTTCCTGAGCCAAGTGTTCGTGGAGCTAGGGAGGCGCGgtctgcagtgtctgcagcgtAACGTGCCAC
GCTACATCGCGTTCGTGGACCGGTGGCTAGTGCAGTCGATCCGCGTGTCGGTGTatcccaagaagaagatgggcACGCTGCGTCTGCTACTAGCGCTGGG
GCTGGCGTTCTCGCTGCCGTATATCGTTCTCACTATCGCTCGCATGCGCTTCCCAACAGGACGAGGGGTCAAAGTGAAGTGAGAAGGTGGCTTACTGTTC
TGAACGAGAAAGGGTGATTAATATTGTATTGTATTATGGTGTGTGCCAGTGCggacgagctcgacgaaGAGAAAATTCGATCGCGTATTATTGTGGACCG
AGGAGACAATTTTGTGCCGGAACGTCGTCAAATGTTCCTtcgtgaaggtggcgacggacTCAAGCTGGACGAAACAACGTCGAAATGCGAGAATACTGTG
CAGGGTGTGAGGTTGCTCACAGACTCGATGGGTAGGCGATGTCGATTGGGTGCTCTTGCTGCATAATGAGCTCATGTCGATATTTTTTTGCTATTATTTG
CTGTTATCAGGTTATGTGTGCACTCGGCCGCAGCTAGATAAGATGAAACCTGGTTGTTGCAACGAGACCGACGCCAGTCTCCCACGGATAAAGCAGTTCA
CGTGCGACCGGTGCGATACCAACCCGCCCCATTGCTGCGACGTATTTGAGCACTGTGTGTCCTGCTGCATGCACCCACTCAATGTACGTGTgccttgttg
ctgtagtGGCCACATGTGCAGTTGTCCATGCGCAGCTGCGCCAGTGGTGCTCTAAGTGTTCACCATGTTGGCGTAAGCCCAATTGAGTCAGTACTTCAAG
GCTTATCTAACCTCGTTGAACTTTGTGCTTCTTGCCTGCAGACCGGTATTCGCCGGGACTTCTTGACGCACGCTGACCCGAACCACCCGGTCTACAGCGG
CCCGGCCGAGATTACCGTGTTCCAGTACTGCCAGTACCGTTGCCGCACCTCGTCCGCGAGCGTGCAGCACCAAAACTCTTATCGAAGGTGAGTCTGCATT
ATGATCAGCTGCGGTGCGTCTTGGTCAGCTGGGTTTAACGTATGGAGACATTTTGCTGCCATGCGCTGTTGACCCAGTCACCGCTCGTTCTGCTACGGCG
TCCACCGGccgctgaaggtgctgccgaCCGTCAACAGCGATG