Description :
From Genome Similarity Track
Location :
Scaffold_197:11479- 13597
Sequence
2118 bases(100 bases per row)
GCGATTAACTCGCTCAGTCTGACCATCGGTCTGCGGATAGTCCTCTGTAGACATGTCCAATCCCGTGACAAGCACCTTGAAGATGGAAGTCCAAAATTTG
CCTGAGAAGAGAGGGTCACGATCAGAGATGATTGCCAGCTGAAACCCGTGTTCACCAAAACACGATCGATAAACAGCATAGCTGTACCTTTTCCATCGAT
GGAATCCGGCGCTGCCGCTAAGTGAGCCATTTTGCTTAAACGGTCAGCAAAGACCACGATTCCCGTATTGCCGTCACAGTCTTTGGGAAGATCAAACAGA
AAATCCATACTGATCGACCCCCAACACCCCATGGGCACAGGTAAACTGGCAAGTGGCGCAGCCGAATGTGCTAAGGGTTCGACCCGCTGACACGTTTCGC
ATGTACGCACGTATGGGCTCACCCATTTGTAGAGTTTGGGCCACCGGTAGTATGGACTCACAGAGCCATAAGTATTTTCCCGGCCCAAATGCCCATTGAG
GGCAGTACCGGGGGCCTCAAAGAGGATTCGATACTTTAAATCCTCATCGTGAGGTACAACAATGCTAGAGGAATTTGCTACATCTGTGCGATAGCACAAG
AGACCATCATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTGCCGATAATTGACTGTCCGAGTCCTTGTAGTCCTCACTCCCAAGGGCATGAAAAA
ATGCCACAAACTGAGTATCCCGTGGATATGCCACACGAATTAACTCCTCAATATGAGACGGCAAAGTCGTGACACGATCAAGCTTATAATCGTTTCGGCG
AGAGAGGGCATCTGCCAACACATTTTGTTTGCTTGGCTTGTATGCCACCTCGAATTAATATTCTGCAAAGAAGAAAAGCCAATGAGCTATTCTCTGGAAG
AGGTGAGGCAACTGTGTCACCGTGCGTAATGACGCATGATCCGTATAGACGACGAATGGCTTGGAGCCAAGCAGATGGACTCTTAATTTGATGAGTGCAT
ACTTCATAGTAAGTAGATCTTTGTCATGAGCTGGATAGTTCTTTTTCAGCAGCTTTCAGCTGACGAGATTCAAATACGATAACTCGATCGCAGCCTGCAG
CATCTGTTTTTAACAGGGCGCTGCCTATAGCAAAATCTAATGCATCGCAGACAACACTAAAAGGGTACTCAGGAGTTGGCAACGCCAAAATAGGAGCATG
GAGGAGACTCTCCTTTACTGTCCAAAATGCGTCAGCATGTGTGTCGTCCCTGCTCCAATCTGTGTCCTTCTTAAGGAGATCAGTTAATCGCCGAGCCATA
TCAGCGTAATGCTCACTGTATATTTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCTTTTTGATTTTTAGGAATCAGCCAGTTCACTATAGCCT
TGATCTTAGCGGGATCCGGTCTGAGGCCGCGCTTACTAATGAAGCATCCTAGAAAAGGAATCTCTTCTGCACCAAAAATGCATGAAGACGCGTTGGCGTA
CAATTTATTAGTGAACATGAACTCAAGCACAGCTCGCAAATGACCAATGTGATTGTCAACATCTGACCAACATTGTTTGGCACGACTATGGACCAAAATG
TCATCAAAGTACGTTTGTGCGTAATCCCGATGTGGGCGGAAAAGTTGCGTCACCAGACGATCAAATGTATCCGGGGCATCACGCAGCCCTTGGGGCATCA
CCAGCTATTCCCATAGCATACCACTCGGAGTTCTCACTGCTGTAAGCGGAATATCATTCGCTCGCATGAGCAATTGATAATATTCATCGACCAAGTCTAG
TGCGCTATCCATAGTACAACCGACGTGTTGTTTTGGAGATTATCCTTTCGAGGAATGGGCGTCTGTGCCGGAATAGTGACCGCATTAAGCTTGTTGTAAA
CATGTACAATATACCAGTTGCCTTTTGGCTTTTTGACACAAAATGTCGGTGTCGAATGTGGAGATTTAATCTCACGAACCATTCCTGCCTCGTGCTTAGC
ACAGAAGAAGTCATCAGTGACATCACATTGATCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTATTTCGTCCCAGGAACTAAGTAGATTCCATGACGA
CACCTCTCTCTATCTGTA