Description :
From Genome Similarity Track
Location :
Scaffold_566:11478- 14403
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_566-snap-gene-0.8Isoform 5 of Actin-binding LIM protein 2

Sequence
2925 bases(100 bases per row)
GCGCAAGGAGAAGGCCACCGTGCTGTTTAACTTCATCCCGCAGGTTCGAGTCGTAGCCCTGTGTGGATGGCAGTTCTGTGTGTGTGCTGACGATGCGATT
ACCCATCTGTGTAGGATACAGCAACGCAGCTTCGACTGACGAAGGGCGAGGAGGTCGAGGTCGTGCGCAAGGTGGGTGTCATTGTGCCGCTGTGTAGTTG
CATCTTCTTGCTTAGTGGTTGTCGCTGCTGTTACTGACTCTGTCTCGATTGGCTGTTGCTGTCAGGACCCGGACGGCTGGTGGTTTGTCGTGAAGGACGG
CGAGAAGGGTCTCGTGCCAGGGTCATATGTGCACATCGACAAGCCGTTCGTCGCTGTGCCGGATGCAGCCATCTTGGCGGCGCGTGAGGCCTCCAACCAG
CGTTTCATGGAGTTTTCTCGCTCCTCGGCTGGCAGCAGCGAGCGGGGATCGGAGGATGGCCCGCACGTGGACAGCCCGAACGAGCCGGGAGCTCCTCCGC
CTGTTTTGCCGCGTGCCCGCGACAACACTGCCCGTGCCGACGCTCGCGCGGGCGAAGGCAGCGCGTGGGAAAAGCCGCAGAATGTGCGCAAGCTGAAGAA
GTGTTTCGCTTGCAAAGAGACGATTCTCGGGCGAACGAAAGTGGCCAAGGATCAAATCTTCCACGAGATTGTACGTATCGATCTGAGCTGAGAGAGGTGA
TCGTGGTTGGTTCGCAAGACCTGACTCTTTTGTTATGTAGTGTTTGCTGTGCAAGGGATGCCGCGAACCCATCGAAGAGGACGAAGATTTTATCCTCATC
AAGAAGAAGGTGCGACTTTTAACGTTTCGAGCTTTGCTGTCAGTTCTGAGCTGACCACGGTTGCGCTGGTGCAGGCTTATCATGCGGAGTGCGGGAAGGA
TGTGGCGCATTGTTATGTGTGCGACAAGGTACGCGATGTTCTTGGTTGGCTGGAGTATCTTTAGTGTGCTTAACGACGTGCACGTTTGATAGGAAATCCT
CGGACGCGTCTACAAGGCTGGCGACGCGTCGTTCCATCGCTTGTGCATGGTTTGCGCACTTTGCAAGAAGCAGGCTGAAGAATGTGAGCTAATGTCTTCG
CGATTGGCTTTGCAAGTGGACGGTTCGCTGACGTGTGATATTCGCAGCCGGATCCAAGTTTGAGAATGATCAGCTCATGTGCGGACCTTGCGTTACTGAG
AAAGGTACTGTTCGAGTTCGTCCTATCGATTCGATGGCGATTCTGACACCTGTCAATTTCTTCAGAACGTAAAGAACGCGAGGAGCGGGAGGCGAAGGAA
CGTGCTGCGAGGGAAAAGGCCGAAGCGGAGGCTGCGGCCCGAGCATTGGCCGAGAAGAAGGTGCGTGAGGCGGAAGAAGCTGCTCGTGCGAAGGCGGAGG
CCGAAGCCGCTGCTCAAGCGAAGAAGGATGCCGAAGCTGCCTCCCGTGCAAGGGCGGAAGCGGAAGCTGCTGCCGCCCGCGCGAGAGAGGCAGAAGAGGC
TGCTGCTCGTGCGAAGGCTGAGGCTGAAGCGAAGGCGAACGCGAAGGCGTACGGCTACGACTCGCGACTGTCGGACACGTCTGGTCTGGATGAGTTTGAT
CTGGAGGCTACTCCAGTGGACATGGCGAGCCACGAACGTGCTTCCGAAGTGTCGGACTTTGGGTCGGTCCTCGACAGCGAGTATGCGTACTCGAACGCTG
GACGCGACTCGATGCGGCTTTCGGAGGTGCTGGACATGGAGTCGATCGACGCGTTCAACAACGGTGGGAATGGCCGGCTGTCGGATATCAGCGGCTTGTC
GATCGAAGCTGGAGCGCCGAAGGAGCGACCGAGGCGATCGACTCTTCAGGAGGACCGCGAAGACATGCTTTCTGATGAGGAAGATCGCGAGCTGTGCGGT
GGCTGCGGACTTGTGCTCGAAGGCGAAGCTGTTGGAGCTTTGAACCAATACTTCCACTACGAGGTGCGTTGCAGCTCGCATGAACTGTGCATTTGATACC
CTTGGCTGACGTTGCAATGCTATCGCTCTGTAGTGCTTCAAGTGCAGCCACTGCCGTCGGGTGATCGCTGAAGACGATGGATACGCAGAGAAGGACAACA
TGGCGTTCCATCAGGCGTGCTACCAGGCTCGCTACGGCAAGAAGTGCTGCCGGTGTAGCCAGGTGAGGGGTTGTCCGCATTCTGCTAGCCCGCAGCTGGA
CGAGGTATTCACGATGCATGTCGATCTCCGTTGCGCAGGTTCTCAAGGGCAAGGTGGTGAAGGCTCTCGACAACCTCTACCACCCGGACTGCTTTGTCTG
CTTCAAGTGCAACTCTTCTCTTTCAGGTAAAACAAAACTGGCTACAACTGCAACGAGACGGGTAAAAGCTCACGCAATTGTTGGGGCTTATCGTCCAGCA
GAGAGTTTCTTTGAGCATGACGGCCAGGCGGTGTGCGCGAAATGCAAGCACGAGGCCATCGCGTATGCCGAGCCCGTGTTCCCGTACGTCTGCATTCGCA
CCGCGTATGATGGATGTGTGTTGATTCTCACACGCTTCCGTGCCAAACAGGAGGACCATGGTGCCAGTCAGCACCGGCGTTGCAGGGTACCGGTTCGACG
CGCAAGACGAAACCCAGCTGTCGATCTACCCAGGTGACAAGGTGTCGATCCTTCAGAAGGTTGGTGCCGTTGGCTGCGTTTCCCTCGCATGTGTAACGAA
CCGCTCACTAACGTATCCTTCTAGGATGATGATGGCTGGTGGTTCGTGGAGGTGAAGAGCAAGCGTGGGTATGTCCCCGGATCGTACCTCATCGAAGATC
CAAAGGAGGAGCCCAAGCCGGCGGCCGTGCCGGGGCTCTGTAGTGAATGCGGCACCCAGAACCCGGGCGTCGCGCGCTTCTGCCGCAGCTGTGGCAACAA
CCTGAAGGAGTAGACGCCTGCGACA