Description :
From Genome Similarity Track
Location :
Scaffold_2:1147575- 1148657
Transcript NameFunction/comments
g1636.t1RAW40286.1 hypothetical protein PC110_g3516 [Phytophthora cactorum

Sequence
1082 bases(100 bases per row)
GTGAGCGACTCGCTCGAGCAGATGCTCAAGTGTCCGCCCAGTCGTTTCTGGGAGCGTCTCCGCATCTACTTCGAGAACGAGCCTGGACTTGATGCTGGTG
GCTTGATTCGTGAGTGGTATGAAATTCTGAGTGACTCGCTCTTTAACGATGACTTCGGTCTCTTCATCGCCACGAAGGGAGAAAACATGGGCTACTGGAT
CAACCCAGCGTCGGCCTCAAAGGTGCCGAACCACCTGGAGTACTACGAATTTATAGGCCGTTTGCTGGCCAAGGCGCTGATTGAGGGTTACAACATGAAG
ATGTCGCTGGCGCTTCCGCTCATTAAGCACATTCTTGGCGTGCCCATTTCGTTCTCGGACTTGGAGTTCCTCGACGAAGACCTGTACAAGAATGCGATGT
GGATGAAACAGAACGATCACGCTGAGTTGTTGGCTATCGATTTCACGGTGCAGGTGATCACTTCGGAGGGCAAGTCACACACGATGGAGCTGGTTCCAGG
TGGTGCTAATCGCGATGTCACGGACGACAACAAAAAGGAGTACCTGGAGCTGCTACTGAAACACTACATGTTTGAGAGTATCTCGGAACAGCTTGGTGCG
CTGCTGATGGGCTTCTACGATGTCATGCCACAGTTCCTGATCACGGTGTTCGACTATCAGGAGTTCGATCTGTTGCTCTCTGGTGTGCCAGAGCTAGACG
TGAACGACTGGCACACGCACAGTGAGGTCCGCTGGATAAAGCTGGAAAAGCCGACTCCTGTCGAGCACCGAGTGCTGAAATGGTTCTGGGAGTCCATGGC
AGAGTTCACCAGTGAGGAGCGCGCCCGTTTGCTGCAGTTCGCGACCGGCACGTCTCGCGTCCCTGTTCAGGGTTTCAAGGCACTTATGAGCAGTGATGGA
CGTGTCCGTCGTTTTACCATCCAGTTCGTGCAGCGTGGGGCCCCGCCCACGGGCCTCATGCCAAAGGGCCACACGTGCTTCAACCGTATCGACCTGCCGC
TCTACCACACGAAGGAAGAGATGGTAAACTACCTCACTCTCGTCATGAACATGGAGATATCGGGCTTCTGGATGGAGTAAAC