Description :
From Genome Similarity Track
Location :
Scaffold_67:114754- 117932
Sequence
3178 bases(100 bases per row)
GATTCCTCAAGAGTTACATGCTAAGAGAACAGGCTCTCAGCAACCTAAGGAAACAAGTTCCCAGGAAGAAATCGAGACATTGAATGTCTTGGTCAATGAC
GGATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGAATGCTGCACGGTACCGGCTCAGACGCCGATACCGAGGAAGGACGTGATCATAGATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTG
ATGGATGGCTCCTATCAGATCCTAATGCGTGAAAGGGACATCCCGTACACAGCAGTGAGCACCCCCAGCGGTATGCTGTAGTAGTGGCTAGTGATGCCAC
AGGGGCTGAGTAACGCCCCTGCAACGTTCAACAGATGTGCAACAAATCTGTTGAGACCGGTGCGGGACTTCGCACCGAGTTACTTTGACGATGTGTGCGT
CCATAGCCGGGATATGGATGGGAAGACGGACGTGGAAGTTTACAGAACACACGTTCGTCAGGTTCTTCAACTTATGAGGAAGCATTAGTTGTATGCCAAC
CTCAAGAAGTGTATATTCGCGGCTAGCGATTTACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCCATCAAGGCGATCACCGACT
GGCCTGTGACAGTCGATGTCAAGGGACTAAAAAAGTTCCTTGAGCTAGCGGCGTACTTGCACAAGTACTCGCGCAATTACGCCGAGATGACTGTGCATAT
TTCTTGTTTACTCAAGAAAAATGTGAAGTGGTCATGGAACGATGACTGTCAGAGTTCCTTTGAACGTATCAAGCAGAGCTTGATGCAGTCGCCCATACTG
GCGATTGCAGATCAGGACAGACCATTCCACGTGGTCTGTGAAGCCAGCGATTTTGCAATCGGCTGTGCGTTGATGCAATTTGATAGAGATGGCGCAGAGC
GCGTCATCTGCTATCAATCGCGTCAGCTGCAAGCAGCTGATCGTAATTACCCAGTGCATGACAAGGAACACCTTGCCACGAAATATGTACTGGCTAAGTC
TCGTGTCTATCTCTTGGGAGATAGACCGTTCATCGTCTATACGGACCATGCGTCACTATGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGAATGGTG
AGGTGGCTTTCCTTTTTCGCGGAGTACAACTTCTCCGTCGAGTACAAACCAGGACGACTGAATGTCGTCGCTGATGCGCTTTCGCGGCGACCCGATTTCG
AGCCGGGCGCGCAATCCAACAATGAGGAGAATCCCACTGTTGCGACACTTACAATCAGTGTCCCGTCGTCAACGTTACTTGACGAAGTAAGAAAGGCCTA
CGCAGATAAGGATTTTCTGCAATTGATGGATTAACTGGTAAATCCAACTCGTAAATCGTTGCAAGATTTATCGGCTTTATACCGTTCCTCATCAGATCGG
TACACAATACGCAACGGGTTGCTGTACTATACAGCCGTTGTCAGCGACACGCCTCGTGTCGCCGTCCCCGCTCATAACGATTTGCGCGTGCGCATAATGT
ATGAGTGTCACGATGCCCCAACAAGTGGCCATCGTGGTAGAGAAAAGACTTACTTTAAGGTAGATCGTGACTTTACTGGCCCCGCCAGTATTAGTTTGTA
CGCAAGTACATTCGTGCTTGCGAGGTTTGTCAACGGGTGAAGCCTAGTCCTTCATCCCGTGCATCCTAACAGCCTCTACCTATCTCGGCAGAGTGCTGGC
AGTCCGTTTTTCTGGACTTCGTCTTCAGTTTCCCCCGAAGACGCTCACAAGAATACTGGTATTCTTGTGTTTTGGACCGGTTCAGCAAGATGGTGCATCT
TGCTGCTATACCCGAGTCGATCACGGCACAGGGCTGTGCTCGTGTCTGCATCGACACAATCTTTCGACTCCACGGGTTACCCTGTGAACTCGTATCCGAC
CGTGATCCTTGGTTCACGGCGGAGTTTTGGCAACCCGTGTTCCGGTCACTCGGAACGCGATTGAAGATGTCAACATCT