Description :
From Genome Similarity Track
Location :
scaffold_9:114740- 116761
Sequence
2021 bases(100 bases per row)
GGCTCCATTTTGTCCTTTGGTAAGGGATATCACGACGTGGTTACGAGAGATCCGCCACACGTGTTATCCCGGATTAAAAAGGGCGCTATGAAATATACTT
TGTTTCCGTATCAAGTATTGCGCCAAACGACGATGGACAACAGTGTGACATTAGAGACATTTTCATCTGTTTAAAGCACAAAAAAATCTCGACGAGAGGG
GTCAATCGGCTTCTCAGCCTTGCCTTTCTTTGTCAGAAAGACTATATGGCAAGTTGCAATTTTGCGGTTGCGAGTCCGGCGCAAATGGTAACTGCTAGAA
AAGATGTGCTGTAAGAAATCGGCGTCAGTCGCATTATACTCAGTGCCCGTGACCTAATAGACGGATCTCATCAACTGCTGACGAGGGACAGCAATAAGTA
CAACAATGTGCTACAACTCCGGAAAGAGTGCTCTGGTTGTGGGTGGTCAGGAAGTATCTTATACACAAGTTTCGCTCAATTGTCTGGTAATATAGCTCTT
CATACTTAATGTGGTTATTTCTCAACATATTATCTTTGTGTCAATGTTAGTGAGGAGTAAGGGAATCTGGATGTGAATGACCGCGTAGATCACTTGCAGC
AGTACTCGAGTGTAACCACTTATTCAAAGTAGTTTCGAGTATAAAAGTGTGTGTCTCTGAGGCCAACACAGTCCCTTCTGAGCTGCGTAATTCGGGGGTA
TGGTCTGCAGAAAAATACGGCAACAACAATTACATCTGTAAAGTGGTCAGATCCTCTGTTCTGACGGACTCAAACAGCTGACTTGACCTACTAATTGCGT
AGATGCAGTATAAATTATGACAACATGTCATGGTATCTCACCAATCTCGTTGGAAAGGATGTGGGCGAGGCGAAAAGGGGCCATCACGGCTGTGAATTGG
AGCTTCTTGCAACACCAAATCTTGCTACCCGGAATTCCGGACAGCCATTTCGTGTCGTACGGGATCTGCCAAGCGCTGTGCTGGGTATGTTCGCATGATC
ATGTTTGAGTGTCTTCAGATCAAAGCATCTGGAAGGAACAGCTCAACTACGACTATAAGCTTCTTGCACTAAAGTATGCTCTTGTTAAGTTTAGGATACT
TCGACTTGGCTTAAGCCGTTTCTGATCTGTAAAGATCATGAGTCTTCGTGAacaacgacgtcgtcaccaccaCATTTTACAAAGAGTGGCAATGCTGttc
tccttctttgccgCGACTACTTTGATGTAAGGTACAAGTCGTTTTGACTTAATGTAGAGGCGGGCGCGCTTTGGCGTCTCGCCGACTCAGATCGTTGCAA
GTCAGAGGCCAAATAATGAGGCAATACGTACGTCCTAAGGATCATAAGCAAAATATATTGCATCCCTGAGCAATTTCGGAAAGCAATGGGCTTGAAAGCT
CAGATGTCGCTTTAACAAAGCACGCGATTGAACGTTTACGCCGCTACTCTTTACCCCACCGCTTGCTGTTTTGCAGTAGCGGCCCATTGGTACGCAACGT
GAAATGGTGCTTCATGATGAGAATCTCAAACACAGAGCACTACACGAGGAATATAATCAGTCTGCTCGGTGGGCGCGATGTATGAGTGGTCTTTTGTGTA
TAAGAGGGTTCGTACAGACGTGAgcattttttaaatataCAACGGGTGGAATTCTTGTCTCATGCGTCGACTTTTTTGGTTAAACTGCCGATTCCGGCCG
AGAGTTGGAAGTACAAACGTATTGACTACATGTTCTATCTTCTATATGATGCGTCTCGTATTACCGTCATTGAGTTTTTTGCGGGCCATTTGAATGAGGT
GACCCGTCTCGCTACTGTCAGTGTCACTGCAGTTGATTTTGATACAGTCAAGCTGTCCTTCGACAGAAATTTTCACTGACACGGCTTCCCTGTAAGTATT
GTGTCGGATAGAAGTTCGCGCTATTCGGTGAAGTTTGGCAAGCACcgtcaaggtgctcggcgcTAGAATTACAATGTCAATTGCAGAATTCGCATACAGT
CAGACGGATCGCTTAAATCGC