Description :
From Genome Similarity Track
Location :
Scaffold_123:114735- 117798
Transcript NameFunction/comments
Phyin_T30-4PITG_20010Putative uncharacterized protein

Sequence
3063 bases(100 bases per row)
GACTTGGGCTCGCAAGGTCTGAAGTTGGGTAGTGTGCAGAGACGCAGCTTGGTCTTGGGCATCTTGAGCCGTCTGGAGCTCCGCCGTCAGGGTTTGCACC
TGATCGGAAAGAGCCTGGGCTAGAACCCGCAGATCGGTGAGCGACATAGAAGACGGACTGACCGGAGGGGTGGTGGATGGGGCCTTGCCCGACGATTTGC
CGGTACGCTTGGCGGGAGACATGTGTCGCGAAGGGGAGAAAGCGGTTGTGGATGCTGGTAATGCACGCCGTGAACGCTGTTGTGCAGCGCCGACAACGTA
CAGGAGGCGATTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAG
GATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGT
ACGAGAAGGCAAGATCCACCAAAGACTTACATCGGATCCACCCTTACCTGGATTCACTTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTG
TGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGAAGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCC
ATACTTCCGAGTTCGGATCCAAGGAGGGAGGATCCCGCCTGGAGGGACCTGGATCCAAGGAATAGAGATGATGGATACAGTGGATCTCGAACTTTCGTGG
GACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATGGGAGAGCTCAGATCGACGACGAGTGCAAACTTACAGTGAAGTGGATCCAAGCGACC
TGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGA
AGAAGGGACATGCAGCCGAGCCTGGTATGGGATTTAACAAGGGAAAGACAGAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGTCCT
CAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAAAACCGGAGCTACATTGGCCGTACGAGCTCCGTGAAGGTTAGGAATTGCAAATCTAGTGT
TGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTCCTATACACGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGG
TCGGCTATACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAG
GCCAGATCCACGATCTAGGGCCCGGAACCATAAGCTCGAATATTCGCTACGGCCAGATCCACGATCTAGGGCCCGGAACCATAAGCTCGAATATTCGCTT
AGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCTACTGCTGCTCCACCCTATCCCCACGTCTCGCCAAGACGCTCAAGCTTCTCCACTTGAAC
TCTCCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGCTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTT
AGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACATCCACTTGGAAGGCTTCCCCCACGGCT
GAGTTGCTCACCACAACCGACTCGGGCAGTGAAGATTCGTGCTGGACACTCACGCAGCTGATGGAAGTATCTTCCGGTTGGGGCCCACGCTGAAGCTTGA
AGAGGGCGTCCTGGAAGAGCTGCATGGCCTTCCGCAGGGTCACAGCGATCTCCGTACACTGCTCCAGCGTACGCGCTCGTACCCTGAACACTCGTTTATC
CGAGCGGATGACTGTGAGAATCCGTGGGAACTGATCGTTGACTTCAATGTGCAGAATACCCGACAGATGAACCGACGAGCGCACCTCTCCCAACGCCATC
GCCGACATGGAAGCCGAATCCTCCTCAGGGATGGAGCCTGTGGCCTTAAAGCACAGCATCTCGGTCGTCGTGAGCATGAAAATCCGCCACTTCCACAGCG
CCACGTTCGCGCTCATTCGACGACTCGCTAGGGACCGTCCACCCATCGTGAAGGTGCCCAGATACAAAATCTCGTCCATCGTGTTGTCCTGCTCCTCCAA
CAAGCAGCTGTACAGGATACCGGGCATGGCGTGGGCGCTGCTACTCGTCAGACCGCCGCCCAGCGTGTTCAAGCTGAAGCTTCCTCGACTACTCACGTCT
GGCGTCCCGATAACATCCAACACGCCGTCCACCGACGGGTTTCGGTCCTTCCCAGAGGCCGGAAGTAGCAACGGCAGCGCCATCTTCTCTCCAGCCACCG
GCGACAACTCCGGGTCGCTCTCTCTTTCCGCATAGTTCGGGTTCGAGCTCTGTCTACTTCTCGAGCTCTTGGGACTGCGATATTCAATGCTTTGTGAGAG
TCAACACCAAGGAGGTGGTCGTGACTGCCCTTGCCGCCTTCAACTCGAGCCCACTCTCTTGTCCAGTACAAAGTCAACTCTCTGCACGCCGACATAGCCA
ACAGCGCCCGGTGTAACGGAAACGACGGCGATAGTGACGTGCGAGGACGTGAGAGCCTTGGCATGCGAAGACGTGAGTGGTGACGTGACCCGCAGTGTGG
CTGAACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCACGGGATCAAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACATT
TTGTCGAGGGTACCACTACGGAAATGGCCACATAGATGACCACGACGGAGGAAACGGAAACGACAAAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGC
ACGCGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGTGGCTACGCTGTGTC