Description :
From Genome Similarity Track
Location :
Scaffold_2:1147202- 1151350
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000771Similar to ola1: Obg-like ATPase 1 (Danio rerio)
Pytul_DAOMBR144PYU1_G000770candidate b-glycosidase related to b-1%2C3-glucanosyltransferases%3B C-terminal membrane anchor

Sequence
4148 bases(100 bases per row)
CTTAGGTGTTGAACTTGAAGAAAATGATGTCACCATCTTCCACCTAAACAGAAAAGTAAGCATGCCGCCATTAGAGCCACACTTTGCATAATCTCACACA
GATACAAAGAAACATACCTCGTAGTTCTTTCCTTGCAACTTCAATTTACCAGCCTTCTTGACAGCTTCTTCGGACCCCACTATTCCATTCATATTGAAAA
CAAATCCCACGCATTAGTAAGACATAAACCATTAAATGCACGTGTAGCCCCTTCAGCAACTTACATTCTTTGAGATCCGCGAACGCCTGCACTTCAGCCT
TGATGAAGCCCTTTTCGAAGTCAGAGTGGATGACACCAGCAGCCTGTGGTGCTAATCTGCCCTTGCGAATGGTCCAACCACGAACTTCATCCTTACCACA
CGTGAAGAAGTGGATCAAGCCAAGCGCTTGGTAGCCCATCTTCAACACGCGAGTCAACGTGGACTTGTGCGTTGGGTTCTCCTTTTGATACGCTTCCAAC
TGACCACCAGCTTCCAAGTCCAACAACTCCAGCTCAAACTCGCAACTGAGAGGAATCACTGGCTCATTGCCGCCACGAGCCTTCACGAAATCAGCGATCT
TTGGCAAGTACTTGTTGCTCTTACGAAGGTAGTCCTTCTTGCTGACGTTGATCAAGTAAACGACAGGCTTGGCAGTCAACAACTGCAATGGGTTCAGCAC
ATCCACCTCGAACGCGCTCCATTGGCCGAACGACACATCCTTGCCCGCTTCAAGCCACTCCTTCACACGCACAAGAGCTTCGTACTCCATCTTCTTCTCC
TTGCCACCAAGACCACGCTCGACATTCTTGCGCATGCCATCCACAAGCTTCGTGACGCGGTCGATATCCTTCAGACGGAGTTCCTCCTGAATGATCTCGA
TATCACGCACGGGATCAACATTGCCTTCGACGTGGGTCACTTCAGCCGAGTCGAAACCACGGACCATGTGGTAAATCGCATCGACGGCCTGGATGTGCGA
CAGGAAGGCATTTCCAAGACCGGCACCTTCAGCAGCACCCTTGACTAGACCAGCGATATCGGTAATGGCGATCACTGGAGGCACGCTATCATGTGGGAGT
AAAACGCATGGATTGGTCAAATGCAAAATCAAAAACAGTAACCTCTCCAGGATCATAGACACAAGAGCGAGACGTACACGCTGGCAGGCTGGTACTTTTC
GACCAACCAGTTGAAACGCTGGTCAGGCAATGGCACGACGGCCTCATTCGGTTCAATCGTGCAGAACGGAAAGTTTTCCGCAGGGATATTGAGCTTGGAC
AAGCAGTTGAAGAACGTACTCTTGCCGACGTTTGGGACACCGACAATGCCGATCTTCACGTTGTTGGTCGGACGACCAAGGTAAACACGTGGGGCCTACA
GATAACAGGAACGATAGGAATGCATACACCAAACGCATGAGGAGAAATGAGAAAAAGATCCATCGTCTTCAATGCGTGCGGAAACGTGCTTCGCCATGAT
TTCCGCGAATGTAAATTGCATCACGAGAATCATCGCGAACTCAGCTACACGATGAGGTATATGCTGCCGATGCACGCAGCGCAACAAGGAAGAGGAGAGG
CACGTACTTCTTCGACTTTCTTCTTTGGCGGCATCTTGCTTTCACTTGCTTGAGGATATTCGACACTAATGGATGGCGTCGCAACCGCGCGCAGAAGCCA
TCAGAGCGAGGGAAAGTATAAAACATATCTAACAACGCGTGTATATGTTTTATACATCAACGCTCCCATTGGTGGAAAAGAGCAATGTTGAATGTACACA
TTGAATTCTTTGAATTCATAAAAGAGGGCACCAAATTGTCAAGAAAGCGGCGTGCTGTCATTTGTGGCAACTGTTGCTGGTTGAGGAACAGTAGGCGTAC
CTGAGCCAAAGTGCATGTAGTGTCTCGCTTGCCTCACAAGAGAGTGTGTGTTTTCTTTTCAACATGTATTTGTAAATTTCCAATGAACGGAGGTGCCAGG
ACGGTTAGAGAGTGGGTGAGTGATACCCAGTTAAAGTGCTGCACCCTGTGCCTGGGCAGAAGCGGCTCCGGGATTGCGAAGCTTCACTTGGTCACCCAGC
TTGTCCATTGCTACAATTACAAACCGTCATCAACAGTGTGAGATCAACTGCCAGCTATAGTAGCCAAGAGACAAAGAAACAAACTCAGCAAAAAAAGCCG
CAAGCACGTACCGCTCTTCTTTTTCTGCGCGACAACGGCAAGAGCAACGAACACCACGAGCATGATCACCAAGAACACACCCACACCCGCAAAGATAATC
TTCGGCGCATCCTTGCTGTTCGAGAGCGTGCTACACGTACTGATGTCCTTCACACTGCAGTCTGAGCCGGTGTAGCACGTGAGGCAGCTGCACGCCTTTT
CGCCGTTGACGGTCAAGCACTGGCCATTCACGCCGCAATCCGAAGATGTCTCACACGCATCACCGCCGCTCGTGACTTCGTAGGTACCGCACAAATCTTC
TTCCGTCGTACCAACCACTGAGTTCACAGCCACGTCACACTTCCCACCACTGTCATCACACACAATGCCTTCACGACTCTTGGCGACCCAAGTGTCGGTA
TCGGCCACTTTCAAAAACGAAGCAGTGCAACTGTCGACAATCCAGCCATTCTCCGTCGCTCGCGTGTTACTCGCCTGAGTGGTAGTCGCAAGAGTTGGAG
ACCACGTGCACTTGTCGGTCGTCGACCATCCAGCTGGATCCGAGTATGGCTCGTATTTGTCAAACTGCGCCTTCAAGTTGGTGTAGTCGGCCGAAGGCAC
GGTACTTGGTTGCTTCAATGGATCCGTGGAACCACCTACAATGGTTCAGCAAAGATATCGTGAGCACATAACCCTGATGCAAAAGACAACGCACAGATAG
ATAAATATTTTCAGATACCGTACCAGTAAACATTGGGAACTTGGCGTCCAGAGCGAGCTTGGCTTGACCGTACGAGTATGCCAGACCGCCGGAGTAAACT
TCAGAAAACTTGTTCGTGTCAGCGGGTTTGCCGTAGTAGTACGGAATCATTCCCCAGTCTCTTGCCACGGCAGAGTCTTCTTTGCAACCATATTCACCAA
ACGCAAGCGCGATGGGTGCACCCTGCGCAAAGTTGATCAGACGCTGGTAGGCTTGAGCAAACGTCGATTTCGGGCACCAACGGTACTCGTTGATCAAGTA
GATATCGATACTTTTCTGCATCGAACCGTCCTTCATCTTATCGCCACAGAGCAGCCCTTGAATCTTGAGCACGTGGTAATCATCGGCATTGTCAATCTTG
CCCGCATAACTACTGTCAGCTGCAGCGTACGCCAATGGGATGATACGCATCTTCTTGCCGTTCACGCGCATCCAGTTTTTCAAATCGGCAACGTATTGCT
TCACACACGCGGCAGCAGTCAGATCCACCTGCATGATTTCATTTGCCACGATAATACCGAGCGTGTTATCGTACGCAGCAAAGTTCTTGGCGATCTTCTT
GCCGTATTCCAGCAGCAGCGCAGGGTAGCAGGTCTCCGTCTGGTCCACGGTTTTCACGCCGTTCGAGGACGTCGTGACTTTGCCGTCCGGTCCAAGCGCC
TTAGTGATCGTCGAGTAACGGTACTTACCAAAGTACTCATCATTATCCGGCGATGCCGACACGAGCACGTAAACGCCGAGCGCCGCCATGTCGGTCATAA
AGTCCTTGTACGACTCGTCCGGGTTGATGTTGTACACACGCAGCGTGTTGAAATTCAAGCCTTTCAGGTTCTTGGCGATAATGGCCTTGGAGTACTGGTT
GTAGTAGGTATCACTCACAGCGTATTCGTAGGTCATCTGCATATAAATTTACATACACACCATCACGCCGCACATCAGTCACGTACGGATACAACATGCA
CAGACGCGCTTTCCCATTATGGAAAGCATAGAATGCGGTAGCAAGAACGTACACCCTTGATGAAAAAGCGCTCGCCGGTCTTCGAGTTGTACATTTTGTT
GCCGCGCACACGAATGACGCCGTCGACCGCCGCAGCCTCGCTGCTGTGCGCCATGAGTGCGAGCGCGAGCACCATCAGCACGGCCGCCATCGACCAGCGC
GGGGACAGCGACACCATCGTTTGCTTTGGCTTCTTTCCTGCTTTTTGC