Description :
From Genome Similarity Track
Location :
Scaffold_1492:1147- 3658
Sequence
2511 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGATTCGTGGAGACACACCCTTCTACTTGGTAC
ATGGGTGGGACCCTCGATCTACTCTGGAGGCAATGGTAACGCTGGGATCGACGCGCCGGCGGGATCGACAGCCTCGCAGGTGGCGCTATCATGTCCAGAA
GCAATATCAGCAGGCCCGGCAGCAAGTCAATGAGCGCCTACGTGAGGCAATTAGAGATCGAGCTGACCAGCACAACGAATCGGTGCGCCCACCCGAGATC
GAGGCTGGAATGCAGGTATGGCTGTATCTCGACCGAGTCAAGGAAGGCTACGCTCATAAACTTGCGCACATGTGGCATGACCCCTTCCGTGTAGTTGAGG
TCGTTGACACGTACGCTGCTCGCCTCGAGATCGCAGGAACCGAGTATCGACTGTTCCCAATTGTGCACGTGTCCAAGCTGAAGCCCGTTCGCACCTTCCC
AGGCCGACCACACCTCACCTTGACGATCCAAGACCAAGATCGACTCGACTTAGACGAGGCTCTATTACCTGAGGATAGCTGGGAAACAAATCTAGGTGAA
GACGAGTATGAGATGGAGCGTATCGCTGACATGCGATCTGGGCGGCGCACACGGTATGGACGTGTTCTGAGAGAATTCTTGGTATACTGGACGGGATATG
ATGAGCCATCGTGGATCGACGAAGCTGACTTGAACTGCGGAGCATGCTACGTGACTATTTGCGGGAGCGATCGAACCGAAATCGGTTCGAGGTCATGCAA
TCGCACGAAGAGCAGTCGTGCGCCGAGATTGTGAGACGGGTTGGCCGTCACACGAGAATCGAGTCGAAGAGTCTGTGGGATGGGCGCAGGCAGGTGGAAC
GGAGGTATATG