Description :
From Genome Similarity Track
Location :
Scaffold_3669:1147- 2235
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3669-fgenesh-gene-0.0Transmembrane protein

Sequence
1088 bases(100 bases per row)
GGCTACGAGAAAGCGATGCCCGTGGACGGACTGACGCTCTTTCCGTACCTGTGGCACAGCATCCTGGGTCCACACTTCGACGACCAGGTCGCGTCTTTGT
CACCGTGGACGCGCTCAGTAAAAGCCTTGGACATCGAGTACCGCATCGTGCGCAACCAGCAAGAGCTCAAGGCTCTGCCAAGCGGCAGCAACGTGCTCGC
GGTCGTCCAGTGGATGCCCAACGTCCTCCACCTGGTCAACTCGGGCGTGCTCGCTGAGGACGCGAACGTGGGCTTCATGGCACTCTCGAAGGAAGATTGC
AACAATGTCAATGCGCAAAAGTACATTGACGCCAAGCAGCTCAAGTTCGGCCTCATGCCCTACGGCGACTGCTCGCTGGTCGACGGCAAACGCTTTGCTG
TTCTCCCGCTGGGTCCGAGCTTTGAGCACGGGTTCCCCACAAACGCCCATAAGACGCTCATCCCACCGGTTGCAGCACGCAAGTTCCTGCTTAACCTCAT
GGTGAGCTGGACCGTCGAGAAGCCGACCCGGATCCAGGCCATGATGTCGGCACTGAGCGTCTGCGAGGGCTACGAGTGCATCGTCGAGCACAACGACCTC
GTGTTCAAAGTGCTCCAGAAATTAGACGAGCTCGCGGGCTCAAACCTGCGCTGGCTGCTCTCATCGGCGCCCAACGCGTACGTTGAGAACCTCAAGCAGT
CGATCTTCACGCTCTGTCCGCACGGGAAGAACCCGGAGCAGTACCGGATTTGGGAAGCGCTCGCCGCCGGGTCCATCCCGATCATCGAAGAGCTTCCACA
GCAGTCACTGCCGGGCGCGTTCTACCATCCGTCGTACCCGTCGACGTGGAAGTGCGTTCCGGAAGACATTCATGGTGTGCTGCGCGAGCTGAAGGCACCG
GTGATTTTTGTGAGCGACTGGCGACGGGACCTGCCGCGCATCATTGACTCGTACGTATCGCATGACGATGGTGGCATGCAGAGGCTCCAGGCACTGCAGC
AGCGAGTGAAGGAGTGGTACGTGCAGCTGGGCAACCATTTGCAGGCGGACCTGCTCCAGAAGTCGCTGCTGCACTTCAAAGCAGCGCA