Description :
From Genome Similarity Track
Location :
contig_57:114681- 116207
Transcript NameFunction/comments
g8901.t1hypothetical protein

Sequence
1526 bases(100 bases per row)
TAGTGTCGAGGACAGTATTTTCCGACAACAAGAAATTAGTGTCCAATCAGCGACAGGGATGACGTTGGTGCAGCTTAGTGGTTGAGCGCTCGTTTACCAA
ACGAGAGGTCGATGGTTCGATTCCATCCACCAACATTTGATTCGGATCATGATGCGGATCATACTGGGGTTTCTTGTTCACATCGAGAGCCGGCGCACAG
AACTGCTAACGCGACCGCCGTCCGGCATTTCGTGTGAACAGGTTGACCGCCAGTATGCTAAGCACCATGAGTCGGGCGCCCCTTCTGACGAAGATTCGAT
GCTCGTTCTGATATCTCAGAACACTGCGTCTACAATCGGAAGTCACAGCGGCCCCAGGCATACAGAGGGATATCGTATCACAACTCCAAGACTAGGATGT
AAGCAAGAATGAAATTTTATGAAGTTGATGGAAAGTTGTCCTTTCTTGCGAACTCATCGGGGTACTCCTTGATGATTTCTTGAAGGTGGGGGTACAGCTG
TGCCACAGTCCAACTCCCATCAACGTCTCGGGACATACCGCAGCGAATCATAGCCTTCCGAGCATACGTCAGCCCGTTCTTGTCTCTGAGGGTGTTGAGC
TCTTGCACACACTCAGCGGCCAGCTTCAAGAAGAAAGGCTTCCCTGGGTTCTTCAACTTACCTGACCACGCACTATCGTTGCGCACTTTGTCCTGCCAAT
CCCCGTCCATGATCAGCTCGAGCTTCTTGGCATTCCACTTTCGCGCCCAGATCGATTTCAGCTTGGCGATGACGAACGAATCCGCTGGCTGACAGAGGTC
AGTGGAGTTGGGTGGCAAAAAGTGCAGATCCGCATTGAGGATTCGCAGCTCTTCAGCGCATTCGTCTGCTGACAGGTGCCCTCCACAGTTGTCGAGAAAG
ATCGCCTTTTTCTTTCCGTGAGGATCGGCACGGATGGCTCGACGTTCGAGCAAAAACTGACGAAACACACGCTTGTCCATCCACCCTTTCGGTCCGGTGC
GGTAACACACGCCTTGAACATCGTCTGGGACGCCTCGTATTGGATAGTTGGCACTGGCGTTCTGTAGAATCATCATCGGTGGCATGACACGACCGCTGGC
GCCACCGGTAAGTCTGACGACCATCGTCATTCCTTCGCCCCCTGAAACGACTTCTGCATACTTAATGGAAGTCTCGCCCACGAAGCCAAGCGTTTTTCCG
GTGTCGAAGTCGATCACAAAGTGGGTCTCGTCTATGTTTTCGATGGTGTCTTCGTCTAGGTCGCCACTGAGGAAGCCATGCTGTAGACGACCGAGGTGCC
TCGCCACGGATGCTCGGATTTCTTTTGTCTTTCTCCGATACTTGTTTCTTCCCCGTTTGTGACCTGAGTACAATACCGTGTTTTTCCATAAAATACTGGA
TCCAAGAGTTTGTCAGCCTCTCGATGATCGTCACGCCTTTGTGGTCGCGGCTTTGCTTGTTGAACTTGCCAGTTGCCTGTTCGACTGTACGGATTGCAAG
TTGACGGAGAAGGGGCGTGTCAAACT