Description :
From Genome Similarity Track
Location :
Scaffold_241:11468- 13187
Transcript NameFunction/comments
Physo_144679hypothetical protein

Sequence
1719 bases(100 bases per row)
TCCGTCTGTCACCACTAACCCCATTTTCTGCTCCCACTATGTGGGATGTCGGTGGTCGCGTTTCAGATGCTGACGTTGAGGCTTCAACTTCGGTGGTCGC
TTCAACATCAGCCTCTGTTCTAGGTCGCTTACCTAAATTCTGTATGATCTTTTCCTCTTCCAGATATACGCTACTGTCCTCAGTAGGGAACGACCTTTGT
ATCATTGCCTGTGTACTTGTTGAGCTAAATTTAACGTCGCGACAGATTAGGTACTTATTTGCCTTGACGTCTAGCAGCCGATACCCTTTATATTTGGGTG
TCAGCCCCAAAAGCTTACACTCGATTGCTCGATCACCGAGTTTTTTTGGTCTGTTCGCTTTATTTTGGGTACATGTGCATAGCATGTTGTACCCATTATG
AGTGCCAAGCCATTTGGCTGCTGATGATGCCGTAATTCATACGGGGTCTTCATCCCCAGTCTGGTCATTCGTAGGCGGTTGGTGATATCTACAATATAGT
TTAAGGCTTCAGGCCACCACTTAGCCGGCATATTGGCCCCTTTCAGTGCACAGCGAACACCAGCCATCATCGTCTGGTGCGCTCTTTCTGCACTCCCATT
CTCTTCTTCTGACTCTACATTTGAACTTTGAAAGTCTAAATCAAGCTTAGAACACAATTTAGACACCTCTGAATTTAGAAATTCAGAACCACCGTCGGTT
CTAATTCTCTTAACCTTAAAAGGAAATTGTACTGACAAATGCTCCATCAAGTCACGATTTTTGCTGGGAACTTCTTTCAGGGATTTTACCACAAAGTACC
ACTTATAAGCAGTAGCGTCATCTACAACGGACAGGGCATAGTGATAGCCAAACGAGCCATATAAGTCATTCACCCGTAATTTTCTAGTTGAGTGTATGGA
GTGGCTCAGTAGCCTTGGCTCCCACCATGTTCTTATAGGACATCCTTCTATCTTTCATTTGGGCGCATGTCTTACAAAAGAAATGAACCTTCTTCAGTTC
AGAGTAAGGTATTTTTGGCTGCCCAGTAATTTCTCGTTACTTAATGTTCGAATTAACCTTTCCTTACCAACATGACCGAGACTCAAGTGCCATTCTTTCA
AAATATTACCAAACTTACGGCTTTGGGCACTAAAAATGCCCGTCCTGGCTTTACATTCGGTAAGTAATATGGTCACTGCTGCAAACAGTAGCTTGAAGTC
TTTTCCTAAGAAAAAGAGAAAATCTCCAGATTTTGACAGAAAGTGCCTGTACCCTTGCTTTGCCAAATAGTATGCACTTAGTAAATTAATGCCACAATTC
CGGTCATATGAGATATCGAAAGAGAGGACACGTTTGCTGGATATTATGTCCTGTGACAATGCTTATTCTGTAGGATACAGAATACGGGGTTAGAGGGGTT
AAACCAGCTTCGGTCTGAAGTTATAGCTCTGCCTGCTCCTGTATCCACGACCCACATATCGTCCGTTTACTTTAGGTTGTTTATATACTGTAAAGAATCC
GTATGAAATTTACGTACTATCTCTTCAACTTCGTCCATATTTGGCGGCAACGGTGACTCAGCCGACTTGCTGTTGTCCTGATTGGCCGGATCCAGACTTC
TGAGGTCGTCCATAATTTGGTCCTCCAGGGCCCTCTCGAGTGCCGTCTTGCCTTCTCCAAAGAGGCGCTTCTTGCCGTCGGTCACGACCGCCGTCATCGT
GTTAATTGCGGCGTTCTTG