Description :
From Genome Similarity Track
Location :
contig_5:114679- 116806
Transcript NameFunction/comments
g1513.t1XP_024574667.1 WW domain [Plasmopara halstedii
g1514.t1POM58476.1 Transmembrane protein [Phytophthora palmivora var. palmivora
g1515.t1RAW37271.1 hypothetical protein PC110_g6455 [Phytophthora cactorum

Sequence
2127 bases(100 bases per row)
TGGAGGACTTTTCTGGAGAAGCTGCACTTCTTCTTGGAGTTCGAGACCGCGGGGGACGCGCTCGCGTGGCTTGAAGACGGCGCGCGCTTTATCGTTCATC
AAGGGGTCGAGGCCAGTCTCGAAGCGTGGCTGGGGCTTAGGGGTTGCTCGCTTCATCAGGTGCTGGAGGCGCTGAACTTCGACTGTCGAGAGGAGCTTCA
CTGGGAGCATTCGATCTATCGCCACGACAGCTTCGTTCGGGGGGACCCTGGCAAGATCACGGAGATGCTAGTCAATGATGCGCCGTTCCTCGGCAGCGAG
AAGGGTATGGCCATGCCCAGTGTCGCCTACAGCGCGGCGTTAAAGCCGCTGGAAGTTCGACTGAGTCTTCCCGAGTCGAACTCGCAGACTTGGGAGGTCA
CCGTCGCACCGAGCGTCCTGCCCCACCCAGGCATCGACGACAAAGGGGGTTTCCACTTTCAGGACTGTCTCGGTGTTGATAGCAGCATGGAAGAGAGCTC
CTTGGAAGAAATGTTTGACGACACGGACCGATTCAACAGCGACCACGACATGAAGTCGCCACTGTGGTGGTCTCAGCACAGTGACTTCTCCAGCATTTGC
ACGGATGATCTGTCCGACATGGATGCGCTCTCTCAGATCAGCGTGTTCTACGGATAGTGGGGCACGTATTTTTTTAAGAAACACCACTAACAGCCAGTTG
GCGCAGTAAAATCATCAAGGAGGCGGATTGAGAGAAATTGCGTACACTGGCCAAACGAGGCAGTAGTGTTGAAGTGAATATGCAGTTTTCCATCTACCTT
ACACAGAGTTTTTGCGCTGGAAACTTGTGGTTGAGTTGTCGGGGTCGGATCTCTCACCGCTCAGGCTTTCCTCCTCGGTCATTGCCACCTGCACTGAGTT
CAGCGGGGCCGACGCCGACGGCACCACACCGTTAGAGTTTAGTGGCACCGCGCCGTCAGTCATGTCGCTCGAGACGTCAACTTCGTAGAAATCGTAGATG
GTCTTGACAGTGACCTCCGAGTCCTTGTTGTTGATATCCTTGTGGTACGCCTCCAGGGTGAGCCAGAAGAGCGGCACGATATAGAGCGCAGAGAACACAT
CGATCGTGTAGTGCTTGCGCGAAGCCACGATCAGGAACGCGATCGCAATCTGCACGCACACCATGATGGTGATTCCGTACTTGTTGGGCCAGAACTTCCA
GACCGTGAGGATAAGCGACACCGTGTAGATCGTGTGGGAGCTGAACATCAAGTCGCCGCAACCGTTGAGAGAGTCGAGGCGGGTGAACCACTCGCTCACA
GTGGGCGGGTTGAAGTCAGGGTTGGGAATAACGCAAGGGACCGGGTCGTCTGGGTTCGCCGCCAAGCACGTGTCGTCAAAATTGAGCTCGCAGTGCGCGG
CTGGGGACGGCAGCGCCGTCACGAGGAACGAAATGCAGCGGAAGACCAGACAGATGCTGAGCTGCAGCAGACAGCGCTTGAGCACGATCACCAGGTAGCG
CGGGCGGCCGGGCTCCTGCTTGAAGAGCGGGATGGTCAGCACCAGGATGATGGCTGGGCCAAAGACAGCGACGAACACGAGGATGTCCGAGAGCGACGCC
GCGGTGCCGGTCAGCTCGGGCATGAGCTCGTAGCCCAGGTCGTAGAGCGTGAAACGCTGCTCCGTGGACAGGTAGTTGCCCTGGATGTAGTACGCCAGGT
TGTGGAAGATGGCGTGGACGTACTGCATGATGACGCACGGCAGGATGATCTTCCACTCGCGGGCCAACAGCTGCAGTTCGATCTTCACATAGTTGATGAA
GTTCTGCTTGTCACGGAGCTGCCAGCGCCTCATAGTGTCGAGTGTTCTGTTTTGGGAGGAGACGGGAGGTAGCGACCGCGGAGGCTTCGCTTCGGATCAG
ACGGAACTGTGCACGGAGACAGGAGGATGGAGGCCAGGTGAGCTATTTTTTCGAGCTATGGACGCGGATTTCGACAGCGACCACGTACGTACCAATGTTT
TCCGCTGCGTGCTGCCGCTCTGATTATCGAGTGGAGATCTGGAGCTCGAGTCGCTCGCCCTCCTCTTCCGCGAGCTGAACGTCCGCGGTCGGCCTGATGT
TTGGTTGTGAGAAGCGGCCAAAAACGG