Description :
From Genome Similarity Track
Location :
scaffold_9:114676- 117302
Sequence
2626 bases(100 bases per row)
CTGGTAATGGAAGATGATCTGAGCTTGTCATCCGTCGTGTACAAACGCAGAGCATTGATTCTCCGGCTCCATTTTGTCCTTTGGTAAGGGATATCACGAC
GTGGTTACGAGAGATCCGCCACACGTGTTATCCCGGATTAAAAAGGGCGCTATGAAATATACTTTGTTTCCGTATCAAGTATTGCGCCAAACGACGATGG
ACAACAGTGTGACATTAGAGACATTTTCATCTGTTTAAAGCACAAAAAAATCTCGACGAGAGGGGTCAATCGGCTTCTCAGCCTTGCCTTTCTTTGTCAG
AAAGACTATATGGCAAGTTGCAATTTTGCGGTTGCGAGTCCGGCGCAAATGGTAACTGCTAGAAAAGATGTGCTGTAAGAAATCGGCGTCAGTCGCATTA
TACTCAGTGCCCGTGACCTAATAGACGGATCTCATCAACTGCTGACGAGGGACAGCAATAAGTACAACAATGTGCTACAACTCCGGAAAGAGTGCTCTGG
TTGTGGGTGGTCAGGAAGTATCTTATACACAAGTTTCGCTCAATTGTCTGGTAATATAGCTCTTCATACTTAATGTGGTTATTTCTCAACATATTATCTT
TGTGTCAATGTTAGTGAGGAGTAAGGGAATCTGGATGTGAATGACCGCGTAGATCACTTGCAGCAGTACTCGAGTGTAACCACTTATTCAAAGTAGTTTC
GAGTATAAAAGTGTGTGTCTCTGAGGCCAACACAGTCCCTTCTGAGCTGCGTAATTCGGGGGTATGGTCTGCAGAAAAATACGGCAACAACAATTACATC
TGTAAAGTGGTCAGATCCTCTGTTCTGACGGACTCAAACAGCTGACTTGACCTACTAATTGCGTAGATGCAGTATAAATTATGACAACATGTCATGGTAT
CTCACCAATCTCGTTGGAAAGGATGTGGGCGAGGCGAAAAGGGGCCATCACGGCTGTGAATTGGAGCTTCTTGCAACACCAAATCTTGCTACCCGGAATT
CCGGACAGCCATTTCGTGTCGTACGGGATCTGCCAAGCGCTGTGCTGGGTATGTTCGCATGATCATGTTTGAGTGTCTTCAGATCAAAGCATCTGGAAGG
AACAGCTCAACTACGACTATAAGCTTCTTGCACTAAAGTATGCTCTTGTTAAGTTTAGGATACTTCGACTTGGCTTAAGCCGTTTCTGATCTGTAAAGAT
CATGAGTCTTCGTGAacaacgacgtcgtcaccaccaCATTTTACAAAGAGTGGCAATGCTGttctccttctttgccgCGACTACTTTGATGTAAGGTACA
AGTCGTTTTGACTTAATGTAGAGGCGGGCGCGCTTTGGCGTCTCGCCGACTCAGATCGTTGCAAGTCAGAGGCCAAATAATGAGGCAATACGTACGTCCT
AAGGATCATAAGCAAAATATATTGCATCCCTGAGCAATTTCGGAAAGCAATGGGCTTGAAAGCTCAGATGTCGCTTTAACAAAGCACGCGATTGAACGTT
TACGCCGCTACTCTTTACCCCACCGCTTGCTGTTTTGCAGTAGCGGCCCATTGGTACGCAACGTGAAATGGTGCTTCATGATGAGAATCTCAAACACAGA
GCACTACACGAGGAATATAATCAGTCTGCTCGGTGGGCGCGATGTATGAGTGGTCTTTTGTGTATAAGAGGGTTCGTACAGACGTGAgcattttttaaat
ataCAACGGGTGGAATTCTTGTCTCATGCGTCGACTTTTTTGGTTAAACTGCCGATTCCGGCCGAGAGTTGGAAGTACAAACGTATTGACTACATGTTCT
ATCTTCTATATGATGCGTCTCGTATTACCGTCATTGAGTTTTTTGCGGGCCATTTGAATGAGGTGACCCGTCTCGCTACTGTCAGTGTCACTGCAGTTGA
TTTTGATACAGTCAAGCTGTCCTTCGACAGAAATTTTCACTGACACGGCTTCCCTGTAAGTATTGTGTCGGATAGAAGTTCGCGCTATTCGGTGAAGTTT
GGCAAGCACcgtcaaggtgctcggcgcTAGAATTACAATGTCAATTGCAGAATTCGCATACAGTCAGACGGATCGCTTAAATCGCTTGAGTTTCACTTAC
GCAATGAGACCGCAGTGGATCAAGTTGTTCTCACTCATCAGATTTTGACTATATATCGCAGTATATGCCTTTTCAGGCCTCCCCCAATTTTATACTAATG
GCTGTTGAACCCTCGTATGCCTTTGACGTTGAAAGTACTACGAAGCGGCTTTTGTCTCAGTGGTGAGGTCTGTCGATCAAATTTGACCTATCCAAATCAG
CCCGGCTCCACTTCCCAATAAAATTGTGCTCAATTGTAATTATGCGGCATGCACTGGGTGTGCTATGGGTCAGTTGTAGGATGTTCAAAGTAACGCATGA
AAATAGGCACGCAAATCACTCACGAATATGTATCGAAGTACGAATTTCGATTAAATGCACATTCTGCGGTATATAAGACTGCGCTGTGATATCGCTAGAA
CTGACCACTTACCATTTTAATGATAAAGAGATCGAGGTATATGCCAAATATCCTAAAGACAGTGCAAACGCATCATGTGTACTAAGTTGCCTTGCTGGGG
CCATTTCACAATCCCGCTCTTATGAG