Description :
From Genome Similarity Track
Location :
Scaffold_70:114615- 116490
Transcript NameFunction/comments
g6136.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGACGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGATAAGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGT
CAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAACCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCA
CAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGA
TGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGGGATATCCCTCTCACGGCGGTAAGCACTCC
GAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGC
GACTTCGCACCGAGCTATTTCGACGACGTATTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGC
TTGAGCTCATGCGAAAGCACAAGCACTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCGTACTTGGGTGTCTCGTGGGGAAGAACGGC
GTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGTCTACGCCTTCAAACCTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGT
GCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTC
GAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCG
GATGCGCACTGATGCAACTCGATCACGAACGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGA
CAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAATTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGT
ACGACGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAATACAAACCTGGAAGGTTGA
ATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGCGCAAGAGGCCGACGCCAACGCAGTTGGTGTCGTCAGGACGACTACACCCTCGTCGTC
CTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTG
GCCAAACACATTCGTGCCCGTGTACACCGTTATCGTGTACACAACGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGG
ATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGA
CTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC