Description :
From Genome Similarity Track
Location :
Scaffold_4:114593- 115914
Transcript NameFunction/comments
Phyca_LT1534503501Hypothetical protein

Sequence
1321 bases(100 bases per row)
gcctactagcaatgcttggcgagtagagactgttgtggtggtaacctcattgataattgtttcgagcttgacgcaaattcgcagacaccatacctattga
taacaatcccagcagttccagcattccagctcttggagcaatacacggaaagtttccgtcggaaacgaagagtacgcatcagtactataacgcaaagccg
atcaacactcagtgtcacgcggctggggcgacccattcttgcccacgagcagcatcatcatttgcatgaactgctcgtgtctgcgacggttttcagcacg
ttcttccgcgcgttcttcattacgatgacgtcgctcttcccgctcttcatcccgacgacgttcctcctcctgtctccgctgctcggcctcttctctgcga
cgttgccgctcctcgtcccgacgttgtctttcctcctctctgtcgaggtcgcgctgatattgcgaccgcaaaacgaccttgagcacagacgtcaacagat
cgtctgtcggcagtggcgtagcctccggcgggaacacagccgctgggttctgccagtccgtagttggaggtgaagcccgtgcaagcggacgtgtaactgc
aggaggcggcgtcgccacagaagccggaataggaactgccgacggagctgccgtggcgacagtagtggtagccactgcagacggtacttcagccgctgtg
tcctcccagccatgctccgattccgctccgtcccggtcgtccgctggtgttggctggaatgaagcttcactcgaatccacgggtgtcgcactatcgacac
ccggaattacagagcctggtgcaggcggcactccttcgaccatctctttatgcacaacgtgcgcgaacgtgatggcttggtggttcttggcgccacgcgg
aggaatattggcgcgatacagacgcgagaacttcttcttgagcgaatcggccgagcggttgtgcttggcaaactgcgcgttgtgtagctgcgcgatgaca
tcccatccgtcacgccagcgcgcacgcaccagctgcagaaggcccatagactcggcctctgtgaagccatcgccacgccgctgtacatgcggccctagtc
gccgcttcacctccgtctccaggacgtcctgtggggaaaagcgtgcagccattttttgggtgggggaagaatttgagagtgaatgggtggatcaaaaatt
ttgctttgacaaagtgcgatcattacagaacagtttacctgacgaaagtatacttggaccaatataccaaaaattgtatgcgatgtttttttaggcgcga
aaatggacggcacagattcga