Description :
From Genome Similarity Track
Location :
Scaffold_89:114562- 119668
Transcript NameFunction/comments
Hyaar_Emoy2808842predicted protein

Sequence
5106 bases(100 bases per row)
TGGTGCATTGAATACTCGAGCCCTAACTCTTTCGCCAACGGTGCAATAAATTGATCAGCCACGCTCCGAGGTGTCGGAAAGCGAAGGCAGGAGCTTTCCA
AGCACCGAGCTTTTGCTTTTGATATGGGGTCCACTTGGTCCTGTCCAGTAGTACGCCGAACACCCTGCCATCTTAGATGCAGTTGCAATATAGGGCCATC
CAACTGGTTTACAGCGTCCAGCAATCGGAACACATTTAGGTGCCGCAATCCAGTGACGTCGTCTCCAATTAAGTTCTGGAAACGAGAAATCGGCGCATGT
CCTGAAAATGTAGCACTCTGGAACGATTGTTTCAGCTTTGCTACCAACGCCTTCGTTCCCATTAGATCTACTAGTGCGGAAGCCACACCTAGCTCATCAC
AACCAGACTCCGTTTTAACGGCCTGCACCGCTGAGGTTACCGATGGCGACGCTGGTGCCTTGTCTTCGACATCATCGGCTTCATCGAGTTGCGATACCTT
TCGTCCAAAGGATCGACACTTCTTAAGATGTATTGCAGCGTCACCTCTCGATGCCGTAACCTGAGCTCCACTAGACTTACAAACCACATCTAAAGCGGCT
GGGGATGAAGCGCTGTTGCCATGTTGGCGGTCGAAGTGCGTCAACACGGCAAGGTTTGCAATATGTTTTCTTTCCGAGCGCATAAACTCCGGCGGCTTTG
TCTTTACTCGGGGTGACCGGCGCAGACATTCCGATCGCGTAGATTCTGGCTGAGACGAAGATTTCTTCATCTTCTTCTTAATTGCGTATGTTGACCGTTC
AGGTGAATGGGCTGGAGTTGATATAGAAGCAGAAGAAAGATGTTCGTCACAATTATCGCTCTTGGCAAAATCACCTTGCAATTCAGGGCTTTGTTTCCGC
TTCGAAGTAACCGCAGCTTTGGTGGTCTCCGAAGACTCGGACTTGGCCTCGCTCCCAACTAAACGTTCTGTAGGAACCCGCAGAGCTGCCCGTACCATTC
GAGATTCCTGTGGCAGCTCTCGACCGTCACTTTGTGCCCTATTTCCAAGGTTCTCATATTCACGTACATTGCCCTCACCCGACGAAATCTCGACGGATTG
ATCATCTTCTAGCTCATCCTCCGTGGAGTTTCCTGTATGGATGAGTACATCTTTCTTCTCAGGCTGCTCATCTTTTGCCACGGCCGTCAACTCTTCGTTT
GCGACACCATTCATTTCTTCACAATGAGAGCTGCTACCTCTTGGGCGTTGTGTGAACTCCGTCAATCCCAGCTCCTCCTCGCGACTAGATGTTTGGCTGC
CATCCGACGATATACAGCTGCTGGTACTCTCACCAAAATCACTAGTAGACTGAGTAGCCGCAGATTCCCGTGTCAATGCAGTCGTACAATCAATTATAGC
CGCCGATGTGGTAACTGCAGCTGTCAGGACTGTTTCGTCCTGATGCGAATAGTCAGATAATCCGTACGCTTCTCCAATGTCGCCACACGAGTGCCATTCA
AGACACAGTCGTCTTGACGAGTTATTACAGCTTACGACATCTGCCTTGTACAACTCAGTAGCCGATGTGTCCGAATTGACGGATTGGGTCGGGATACTGG
CATCCAGCTTTTGCTCCACAAACTCTGGTTCGTTACCTGTGCAGGACATTTCCACTAGTGTGCTATACTTCTCGCAAGATTCACTGCCACCTGTAAGCGC
TTTTACGGTGGACCAAGTGGAGCCGCAATCGACTTCACTTTCGTCTTCATCGTCCGCCATGTAGTCGCGCTTGACTTCATCTTCGTCGTCATCATTCCCG
GGGCTTTCAGCAAGCTCTGGTGTATGTACTGAGACTGTAAGCGAAGGCACGTCTGCCCCCAATCCAGTCGCAGCCATGTTTTTCATCAACTGCATCACTG
ACCCAGCCAGCTTTTGGGCTGTCCGGCAACTATTCTCTAGCGATAAGCGCGGCAGGGTGCTCAATTTGCTTAGCTTCTTGGTGTCGCTTAATCAATTTGA
AAGTGAGGGAATGCGAGGCGGCGAAGAAGAGTTAATAAATTTTTCCGGGACGAGACAGGACGCGACAGGAAGATTGACCCAAAGAGAAGCCACACCTGTC
GAGACACTTCAATACCATCGCAGACATTCACACTCAACTACATGCTTCACGGTGCGACGAGCTATTTCCATGTTGGCATCTGTGTCATACAATCGTGGTA
TCTTATGCGTTCGAAGCATCTGCACACCTCGTGAACCGCACAAGTTTCTTGATAACAGCCGCAGTAGAAAGCAACACCTGCGGTCATGGTAACTCGTTCG
TCTTTCAATCTCGACCCTGGCACGCGAAACAAGGCCGTTCGAACTATTTTAAGTAACGAGCTCGCTCTCCTCGGTAAGTTCTGTAGTGCTGTTGCGAATA
AAGCTACGCGGCCCCAACTACGTTCCAGGAATAACGTGAACACGTCAGTCTCAGCACCCGATAATCATTCCCTACAATGATCCTATGCTACGGTAAGCTG
CAACTCGTAGTTTTGTCGCTGCCTCAGTTACAGTTGGACCGCTGGGGGCTGCGGATACATTCTTGTCTGGACAGGAGATTCGAGCATAGCAGCACGCACT
ACCGCTCAGGTGTTCTAAGCGAGTCTTATATTCTTGGTTTCATCTGCTAGGTACTACTAGGCTCACAATGCACGCACAACAGCGACTATTTGAGCGGATG
ACCATTTTTTAGTGCGAGAAGGTGATGTTGGCGCAGTGACTACAACCAGATTTTTCTTTACTGTGGTGACCTACGTAATAGTGGATCTGCTGTGTCCTTG
CCAGACTCCTAACATTTGCTGACTTGATTAGCTCGTAAGCGAGAAGGATGCTGATGGTGGTGGTGGTGGTGCGGGTCTCGTCAGGGTAATCGCGGATATG
ACCTGGTGTAAAACCAGCCCCTATTGTAGACTCTTGACCCCGTTGAGGCTTGCAGATACCTGGTTCACGACTCGCAACTTGGCATAGGGTGACTGAAGTC
GATACATTCTTTCTAGAGACGGCTCTCAAAAATACACATGGATGCCTCAGCAACTAACGGGGTCTTAGCTCCTCGGGGGTCTCCTTTACTAATGGTGCTT
AGCTACTGGGATATCTCAGGAACTGGGATGTATCTGCTACTATAAGCGAGTCGAATGAAATAATTATTGTGAGCCCGAAGGGTGAAGCTTATGTGACTGT
GCGCAAAATGAATACCAAAGTTTTCAAGCCCTCCTTCTGTCTTTCTATCTGTCTATGTGTCTGTAAATAACGCTAGGTGTGCCTTACGTCGTACTAAGCG
ATGTAACCTGTCCCCTTTTCCAATGGGTAGTACGCTGTGTGTATAAATATAGGGACTGAGTACGTAGACACCCCCTACTTACAACGTGGACACCCTTGGA
GAAAAATACAACAATTATCTTACAATACAGGTGCCCCCTAGGTCGGATAATATAAAAGGGAGCCAATGTAGTGCAACACAGAATGTAAGACCCCCCTCCA
CTCCACTCCTCTCCTCACTCCACCGCACCTCACGTTCTAGTGTAAAGTTGTTGTGATCTTGCCCTTATTTGGCATAGCCTTCTCCCTGATCTCTTGTTTC
AGTTGTATCCCAGAAACGCACATGGCTAAATGCATGACCCTAAAAATTAATTTATAAGAGCAAAAGGTAGATCATGATGGAGTACCGATAAATCAACGAT
TCGCACCCTGAACTTTTGTTGAGGATTTAGAGCATACTGAATCTGTATTCTTACGATTTGAACCATGTTTTATAAATATCTCGATACACACTGCGCAGAC
GCTTGTACCACCGCCTACATACACGGTCTATAGAGGCTGCCGGTAGAATCGTGTATCGTCAAATATCTTCTCTCTGCTCCGTATCTGGAGACGCTGAAGC
AACGTAACATAACACACCGCCAATATATATTCATCGGTATTAGTGTAAGAAAAAAATATATGGTGAAGTAGTTAGATATCTGCATCAGTGTAAAGCTTTA
TTTTAATTTACCACACCGAGATCTGGCGTTTGTAAAGCCGCCGACGCAGCAGTCAGGTATGCGACGACACGAACGACAATACTATCTTGTCCACGTTGAT
TAAAACGGAGCTGCTACAACAATGTAATAGTGTTGAACACTATTACGCACACCGAACGCGCTGGCGCTGGCTCTGCGGCTTATACGGGATACCGCAATGT
TCATCAGGAGTGAAAGAACCTATTAATTTTCAGCGAGGGCACCGGCAGCGTGAGATAATTTATTGTACTTTTTATATAGGGGGTGTCTACCTAGTCAGTC
CTGAAACATAATAGTAGTTGTTGATTGCTGTGTGTTGTTATACTCGTTGATAGCATTAAGGTTTGAAGAGTCGAATCTGACGGAAATAAGATGAGGGTGG
TCCTGCCCGGCAACGCCGTTGCAACTGAAAGATATGAAATTGCGGGAGCATCTTCTGCTACCGAGAGAAAAACGTGACAGTAAGTTCTATCGAATTCAGT
TTGCCAAAAACTTCAGATGAAAATTTCTTCACATAAACTGTTTACCGGAGGTGCGATAATTTCGCTGCTTCTAAGTGTCGAGCAATTGTTTGATAGCCCT
CTGTCCTCTCTTGGTTGATTTTGAGCGAACCACATTCGGTTGTTGGTTCGTATGTGGCTAACACATTCTACGCAATAGCAACTGGTGACTTAGTCATGGA
GCTGCACTTATATTGCATATTTACATTTGAGCAGGGAACAGGCTACATCCCACTTGGTACGAAGTGTAAGGTACATCTAAAGTTAGTTACAGACACGCAC
GGACGGAGAGTAGCCTACAAAAAGAAACCTCCTCCGCACCGAAAATGCAATTAGAAATGTTGGCATACAATTTATTTGGATGCATTCACTCAATTACTGC
TCATAAATGCTCGATCTATTGTTCACATCCGACTGTAACTGTTCTGCACGACTATGGACAAAGCGTCATCAGTGTCGCAACTTTTTTGCCCGCATCGGGG
TTATCGTCTGTGCATAACCCCTTTTGGGGACGAAAAGGTTGCGTCACCAGACGATTAAATATATCCGTAGCATTGTATAGCCCTTGGGGCATAATCAGCC
TCTCCC