Description :
From Genome Similarity Track
Location :
Scaffold_241:11454- 13179
Transcript NameFunction/comments
Physo_144679hypothetical protein

Sequence
1725 bases(100 bases per row)
TTTTATCTTAGACCTCCGTCTGTCACCACTAACCCCATTTTCTGCTCCCACTATGTGGGATGTCGGTGGTCGCGTTTCAGATGCTGACGTTGAGGCTTCA
ACTTCGGTGGTCGCTTCAACATCAGCCTCTGTTCTAGGTCGCTTACCTAAATTCTGTATGATCTTTTCCTCTTCCAGATATACGCTACTGTCCTCAGTAG
GGAACGACCTTTGTATCATTGCCTGTGTACTTGTTGAGCTAAATTTAACGTCGCGACAGATTAGGTACTTATTTGCCTTGACGTCTAGCAGCCGATACCC
TTTATATTTGGGTGTCAGCCCCAAAAGCTTACACTCGATTGCTCGATCACCGAGTTTTTTTGGTCTGTTCGCTTTATTTTGGGTACATGTGCATAGCATG
TTGTACCCATTATGAGTGCCAAGCCATTTGGCTGCTGATGATGCCGTAATTCATACGGGGTCTTCATCCCCAGTCTGGTCATTCGTAGGCGGTTGGTGAT
ATCTACAATATAGTTTAAGGCTTCAGGCCACCACTTAGCCGGCATATTGGCCCCTTTCAGTGCACAGCGAACACCAGCCATCATCGTCTGGTGCGCTCTT
TCTGCACTCCCATTCTCTTCTTCTGACTCTACATTTGAACTTTGAAAGTCTAAATCAAGCTTAGAACACAATTTAGACACCTCTGAATTTAGAAATTCAG
AACCACCGTCGGTTCTAATTCTCTTAACCTTAAAAGGAAATTGTACTGACAAATGCTCCATCAAGTCACGATTTTTGCTGGGAACTTCTTTCAGGGATTT
TACCACAAAGTACCACTTATAAGCAGTAGCGTCATCTACAACGGACAGGGCATAGTGATAGCCAAACGAGCCATATAAGTCATTCACCCGTAATTTTCTA
GTTGAGTGTATGGAGTGGCTCAGTAGCCTTGGCTCCCACCATGTTCTTATAGGACATCCTTCTATCTTTCATTTGGGCGCATGTCTTACAAAAGAAATGA
ACCTTCTTCAGTTCAGAGTAAGGTATTTTTGGCTGCCCAGTAATTTCTCGTTACTTAATGTTCGAATTAACCTTTCCTTACCAACATGACCGAGACTCAA
GTGCCATTCTTTCAAAATATTACCAAACTTACGGCTTTGGGCACTAAAAATGCCCGTCCTGGCTTTACATTCGGTAAGTAATATGGTCACTGCTGCAAAC
AGTAGCTTGAAGTCTTTTCCTAAGAAAAAGAGAAAATCTCCAGATTTTGACAGAAAGTGCCTGTACCCTTGCTTTGCCAAATAGTATGCACTTAGTAAAT
TAATGCCACAATTCCGGTCATATGAGATATCGAAAGAGAGGACACGTTTGCTGGATATTATGTCCTGTGACAATGCTTATTCTGTAGGATACAGAATACG
GGGTTAGAGGGGTTAAACCAGCTTCGGTCTGAAGTTATAGCTCTGCCTGCTCCTGTATCCACGACCCACATATCGTCCGTTTACTTTAGGTTGTTTATAT
ACTGTAAAGAATCCGTATGAAATTTACGTACTATCTCTTCAACTTCGTCCATATTTGGCGGCAACGGTGACTCAGCCGACTTGCTGTTGTCCTGATTGGC
CGGATCCAGACTTCTGAGGTCGTCCATAATTTGGTCCTCCAGGGCCCTCTCGAGTGCCGTCTTGCCTTCTCCAAAGAGGCGCTTCTTGCCGTCGGTCACG
ACCGCCGTCATCGTGTTAATTGCGG