Description :
From Genome Similarity Track
Location :
Scaffold_12:114526- 115840
Transcript NameFunction/comments
Phyra_75283Ptype ATPase (PATPase) Superfamily putative

Sequence
1314 bases(100 bases per row)
CGATCGTGTCGCAGACGGTCATCAACTCGCTGCGTATTTTCCCCATTATCTTGGGCCTGAGCTTTCAGGCCACGGTGCCCGTGCTCATCCTGTACGTGAC
GCTCGTGCTGGGCTGGCATGGCACCAAGTTCCTCGTGCCCAAGTTCCTGCTCAGCTACAAGATCGGCATGCAACTCACGCTGTTGGTGGACGTCATCTGG
TACTACAAGGGCTACAATGGCAAGCTCAATAGTGTCAGCAGCGGCACGTCCGTGCTTATGCAGGGCTTCTTCTCCATCTTGCTCACCATGCTCAACATCA
CGGGTTTCATGTACGGCTGGAAACTCCGCCGCATCGTCAAGGCCGTGCAGAACCAGCGAGAGTGCGACCGCGCAGCTCTCGCCACGATGATGCCGTCCCC
GCTGCGGGCCAACTCGCTGCATCAGACGCTGTCCATCAACCCGTCGACCCATGAGATGGACGAGGATGAAGGTCCGTCAGCCAGACGGAAGATTGTGGTG
GGCCCGGGCATCCCCAACAACAGGTTGCGACGCAGTCAGTCGGGTGTGTCGATGACGTTGCCCGACGCGTTGAAGACCAAGAAGCAGCGCAGGAAGGAGG
CAGAAGCCCAGGAAGAGGCGCCTGTCTTCTCCTCCAACCTCATCGTTACGAGCAAGTACACGTACTACAACTTCCTGTTCGTGTTCCTCAAGATGCAGTT
CAGCCGACTCGCCAACTTTTATACGACCATCGTGGTGGCGCTGTGTTTCTTCGACTTTTCGCCAGTGAGTCCCGTGGCTAGTCTGACGCCATTGCTGATC
GTGTTCGCGACGTCTGCACTCAAGGACGTGAGCGAAGACCTGCGTCGCCAAAAGGGAGACGCCATGGTAAATTCCAGGCCGGCGCACATTATTCGCCGCG
ACGTTGTGAATGAGGTGATGCACATCGATGGCACTTGGCAGGATATCGAAGTGGGAGATGTACTGATGTTGAAGGACGGCGATCAGGTTCCGGCTGACTG
CATTTTGCTGGCGACAAGTCGACCCGACGGCCGATGCTACGTTGAGACGGCCAACTTGGATGGCGAAACTAACCTGAAGATCCGCCAGGTAGCCAGCTGC
ACGAAGCACTTTATGACTGCAGAGGAGATTCTGGAGAAGTACAAACTCCAGGTGGAGTGCGACGTGCCCAACAAGGACCTGTTCTATTTCGACGGCGTGC
TGAGACTTGGAAAGATAGCAGACGATGCGGTTGCAGATGCCAACAACGACGACAACGAATCAAGTTTGACCATGGACAACTTGCTTCTGCGTGGCAGTGA
GAGCCGCAACTCTG