Description :
From Genome Similarity Track
Location :
Scaffold_126:114480- 115767
Sequence
1287 bases(100 bases per row)
CCAGTCGATCCAGGGCTCGTGCTGCTCAAGCCAGGGCATGCCCAGGATCATATCAAAAGGATCCATATCGAGCACAGTGAACTGTTCGAGGCTGTCAAAG
TCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGAGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTC
TCAAAGCATCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCGATCAAGATTCTAAAGGGATGATC
GTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCTCGTGGTACGCG
CCACCTGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGGATCCTGGATTCTG
CCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTAAAGTGGCCCATATTTCCACAGCCGAAGCAG
CGGATGTCACGCTGTTCGGCGGACCTGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGG
CCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGC
GGGGCCCACTCGAAGGCCGTCCATGAGCACAGTCATCTTGATGTGTTCGCTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACA
TACTCGTGCAGCTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGAAGCTGTTCGC
ACAGCTGAGCACAGGATGTGAAACATCCAGGGGAGGTTGCTTCCCGTGTGTACACCCAACTCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAAGCAAC
ACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTA
GCCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCC