Description :
From Genome Similarity Track
Location :
Scaffold_32:114477- 117074
Transcript NameFunction/comments
Physo_134466reverse transcriptase

Sequence
2597 bases(100 bases per row)
GCCGCGTCGGGATATGCGACGGACCTCACGGTCAACGAGGCGGAATACCGCGGGCGGCTGCTCGGATGTTCTCTTCTAGAGGAACTCGACGACGTCACCC
GACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCG
AAACGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAA
GGAGGCCGCAACGCGCACAGCCGCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTTGGAAGAAGTCCATCCGACCACGGGCATCGAGTCCCGAGATG
GCGTCTCCAGCCAGTCCCGACGCGGATAATCTCGACGCGGAAAACCTCGACTCGGAAAATCGCGACGCGAAAACGCGCGGCGCAGATGACCCCGCCGGGA
AGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGTCCGACCTCCAGAAGT
CCTGGAGGAGCTGGTGGTACAACGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAAGTAGTATCTCCGCGGC
GACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAA
GCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGATGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAAGG
CGGACACCAGGGTATTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGACCAGCGCTACGTCGGCGAATGCACC
GACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGTACCATATTC
CGTCGTTGCCGGCCTCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCATCACGAACCGC
GCAGACGGTGACCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTC
TTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTTGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGTTA
CAGGAGCGATCAAGATGTACATCGCGGACGTCGACCAACGCGACTGGGAGGAATACGCCGAGCGTCTTACCTTCGCGCTAAACACGTCGCACGACCGGAC
GAGGAATGAAACACCGTTCTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCGGCGTTGGCCGTCGGGAACACGTCGACCCAGGACGCCGAG
GCGAGGCGGTGGAGGCTCCGTAACCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGAAGAGAGAGCGCGTCGAC
AAACTGAAAACGCGACGCGACATGAGATCGCGACGGGATCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTCGCGCACAT
GTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTTGAGACGACGGGTACGCCCTATCCGCTGTACCCCGTCGTCCACATC
TCCAAGCTGAAGCCCGTCCGGGAATTCCCGTCGCGACCCGCGACGCAGCTGACGGTGCCGGTCGAGGAGCGCTTCGACTTCGACGAGGCGCTCTTGACGG
AGGATAGCTGGGAAGCCACGCGCGAGCTGGAGGACGACGGCTTCGAGGGCGAGAAGATCGTGAATGTGCGCGAGGGGCGGGCTACCCAGTATGGGCGCAC
GCGACGCGAGTTTGAAGTCAAATGGAAAGGCTACCCGGACACGACGTGGGTCGACGAGCTCGATCTGAATTGCGGCGGGTTGCTGTACGACTTCCTGCGC
CAGCGCACGGGACGCAACCGGTTCGAGGCGATGTAGTCGCACGAGAACGCGGAGGTGGTGGAGCCTGGTGGGTGAGCGCCCGCGGGTGCGACTAAGTCGG
CGGGGGGGGGGGCTGCCGACGGGAGGACTGGTGGGAAGCCTCGACTCTGGGAATGGCCGGAGCGAGGGATTGGATGAGGGAAGTGAGGAGGACCAGCCTG
TTGCTGAAGATGGGACGGCGGAGGGCCGTCTCATAAAAGATGTGGAGAAGTGGAAAGAAACAAGGGGAAAGATCAAGGCTACGTGTTGAAGTTACGGCTA
CAACAACTAAACGCGACGGACTGCAACGATGGGCCAAGACTCAAACCTGCTGGACAAACTTACCTGCAAGACGCGGCACATGGAAGGCTGGGTGATC