Description :
From Genome Similarity Track
Location :
contig_5:114460- 116580
Transcript NameFunction/comments
g1312.t1WW domain
g1313.t1hypothetical protein AM588_10003927

Sequence
2120 bases(100 bases per row)
TGGAGGACTTTTCTGGAGAAGCTGCACTTCTTCTTGGAGTTCGAGACCGCGGGGGACGCGCTCGCGTGGCTTGAAGACGGCGCGCGCTTTATCGTTCATC
AAGGGGTCGAGGCCAGTCTCGAAGCGTGGCTGGGGCTTAGGGGTTGCTCGCTTCATCAGGTGCTGGAGGCGCTGAACTTCGACTGTCGAGAGGAGCTTCA
CTGGGAGCATTCGATCTATCGCCACGACAGCTTCGTTCGGGGGACCCTGGCAAGATCACGGAGATGCTAGTCAATGATGCGCCGTTCCTCGGCAGCGAGA
AGGGTATGGCCATGCCCAGTGTCGCCTACAGCGCGGCGTTAAAGCCGCTGGAAGTTCGACTGAGTCTTCCCGAGTCGAACTCGCAGACTTGGGAGGTCAC
CGTCGCACCGAGCGTCCTGCCCCACCCAGGCATCGACGACAAAGGGGGTTTCCACTTTCAGGACTGTCTCGGTGTTGATAGCAGCATGGAAGAGAGCTCC
TTGGAAGAAATGTTTGACGACACGGACCGATTCAACAGCGACCACGACATGAAGTCGCCACTGTGGTGGTCTCAGCACAGTGACTTCTCCAGCATTTGCA
CGGATGATCTGTCCGACATGGATGCGCTCTCTCAGATCAGCGTGTTCTACGGATAGTGGGGCACGTATTTTTTTAAGAAACACCACTAACAGCCAGTTGG
CGCAGTAAAATCATCAAGGAGGCGGATTGAGAGAAATTGCGTACACTGGCCAAACGAGGCAGTAGTGTTGAAGTGAATATGCAGTTTTCCATCTACCTTA
CACAGAGTTTTTGCGCTGGAAACTTGTGGTTGAGTTGTCGGGGTCGGATCTCTCACCGCTCAGGCTTTCCTCCTCGGTCATTGCCACCTGCACTGAGTTC
AGCGGGGCCGACGCCGACGGCACCACACCGTTAGAGTTTAGTGGCACCGCGCCGTCAGTCATGTCGCTCGAGACGTCAACTTCGTAGAAATCGTAGATGG
TCTTGACAGTGACCTCCGAGTCCTTGTTGTTGATATCCTTGTGGTACGCCTCCAGGGTGAGCCAGAAGAGCGGCACGATATAGAGCGCAGAGAACACATC
GATCGTGTAGTGCTTGCGCGAAGCCACGATCAGGAACGCGATCGCAATCTGCACGCACACCATGATGGTGATTCCGTACTTGTTGGGCCAGAACTTCCAG
ACCGTGAGGATAAGCGACACCGTGTAGATCGTGTGGGAGCTGAACATCAAGTCGCCGCAACCGTTGAGAGAGTCGAGGCGGTGAACCACTCGCTCACAGT
GGGCGGGTTGAAGTCAGGGTTGGGAATAACGCAAGGGACCGGGTCGTCTGGGTTCGCCGCCAAGCACGTGTCGTCAAAATTGAGCTCGCAGTGCGCGGCT
GGGACGGCAGCGCCGTCACGAGGAACGAATGCAGCGGAAGACCAGACAGATGCTGAGCTGCAGCAGACAGCGCTTGAGCACGATCACCAGGTAGCGCGGG
CGGCCGGGCTCCTGCTTGAAGAGCGGATGGTCAGCACCAGGATGATGGCTGGGCCAAAGACAGCGACGAACACGAGGATGTCCGAGAGCGACGCCGCGGT
GCCGGTCAGCTCGGCATGAGCTCGTAGCCCAGGTCGTAGAGCGGAAACGCTGCTCCGTGGACAGGTAGTTGCCCTGGATGTAGTACGCCAGGTTGTGGAA
GATGGCGTGGACGTACTGCATGATGACGCACGGCAGGATGATCTTCCACTCGCGGGCCAACAGCTGCAGTTCGATCTTCACATAGTTGATGAAGTTCTGC
TTGTCACGGAGCTGCCAGCGCCTCATAGTGTCGAGTGTTCTGTTTTGGGAGGAGACGGGAGGTAGCGACCGCGGAGGCTTCGCTTCGGATCAGACGGAAC
TGTGCACGGAGATAGGAGGATGGAGGCCAGGTGAGCTATTTTTTCGAGCTATGGACGCGGATTTCGACAGCGACCACGTACGTACCAGTGTTTTCCGCTG
CGTGCTGCCGCTCTGATTATCGAGTGGAGATCTGGAGCTCGAGTCGCTCGCCCTCCTCTTCCGCGAGCTGAACGTCCGCGGTCGGCCTGATGTTTGGTTG
TGAGAAGCGGCCAAAAACGG