Description :
From Genome Similarity Track
Location :
Scaffold_259:11445- 17458
Transcript NameFunction/comments
Phymu_g7662hypothetical protein

Sequence
6013 bases(100 bases per row)
tggtgcttgcgctgctgctgccaagtGCTGGGGCCTTCCGCGTGATAAACTCGCCGACAGATCGGCTGATAGGGACGCACGCGGTGTTCGAGCCGTATGA
GACTGGCTCTGTGGGCTACTACGGGGATCCTGCCAACCCGTCGGCCGAGCGGCTGAACGAAGGCTCGCCGTACTCCCCTGACACACCgcggatcttcttc
agcactcCACTACTACGTacgtctggatctggatgatGATAATTGCCAATTGATTATCTGCAGACTGAGAGTCGTTCTCCACAGAGCCGTGTCCAGGGAT
GGTGGGGCCAGGACGCAATGGCGAATACTACTGCTTCAGCCGCGAGTACGGTCACTGCGACCGACGAAGCGGTCTCTGTGTGTGCAACCAAGGCTACACT
GGTTTGGATTGCACAGCATGCCAGCCGGGCTATTTCAAACAAGGCGGCTTGTGCTTCGCCAAGAGTTGAGTATCCATCCGTGTCTGTTGGGTATCGATTT
GCTTTGGACTAACCAGCTGCAATTGCCTTTACAGAAAGCTGTCCAAACGATTGCTCGCGTGGTGGAGAGTGTGACTACGCGACAGGAATTTGTACGTGCG
AGCCCACACGACGTGGAACAGACTGCTCGCAGAGATTTTGTGCCTTCGACGAGAAATGTGTGAGTTGTACGAGCACTTCCTGTCTGAAATGTGTCGAGCG
ATTCTACGTAGACCCATCTACTCAGACTTGTGGTACGCTTTTGGCGCTGTTTTTGTGGCCATGGGCTCTGAAACCTTTGACTGACTGGTACTGAGTAGTT
TCGTGCGCGCGCTTCGATCCGCGGTGCCTCAGCTGCAACTCCATCGGCTGCCTTGGGTGTGCAGATTTACAGCTTAACTCAGTGCGTCGTAGTGGAGCGC
GACGAATTGATCCACCACTGCCGGACGACGAACGCATGCGTGAGTTCTCACAGACTTTCGTTTACGGCAGCCAAGACCCGCGGGTTTTCGATGAAGCCGA
GTCGTTCACGCTAACCccatcctcttcctcctcatcaCCTCTGAACGAGAGCAGTGTTTCCTGCATCCAAGGCGGAAATGCGGACGCTGGATGGACGTGC
GCGTCTCGTCCTGAATCGCATCGTGTTTGTGGGCATCGCGGTGTTTTGTCTTTTGCGTCGCCACTGTACGCGATTGCCGAGGGTGCAGGGGAAATCACTG
TGACGGTCCAGCGATCCGGGGGTGGACTTGGAAGTGCTGCATTGCTGTACGATTTAGAGCACATTACCACGACACCTAGAGACGTTTCTCCTACGGCGTT
CTACACCAGCTCACAACGGTTGGAGTTCGGCCCTGGAATTGTGTCCCTGtccttcaagctgcagatccacGATAATTTCGTCTTGAACGATGACAAGACT
TTCaggcttcgtcttcgtgaACCATTTCCTCCGACAGACCTACTTGACGTAGCACCTGCAACATTGGGGAATCAGTGGCGCACACTCGTGACCATTTTGG
ACGATGATGCCCTCCGGCCAGTTCCCGATATTACACACGTAGTTAATCCGGAGTCTACGCTCATGCTAGGTGGAGCCGCTGGAGACACGATGACTTTCCA
GGTCCAGAGTGTCTTGGGGAGCGGGGTTCCAGGTGTTGATCCTGCCAGTAAAGCGGTCCTCCTTTTGACCTCCTACATTGAAGACTATGATACCAGTACT
GGGGCTACTGCATTCCGGAAACTTTTGCTTGGAACTGTCACGCCTAGTGGGGGCGTGGATGCATCGCTGTATACGTGCACTTGGTCACGTGAACGTGCGG
GCAATTACAGTGTCGCAGTTCAATTGTTGTACCCTGGTGGGTTGCGCGGAGAGTACTTCGGAGATGCTTGGCTAGGAGAAGCGTTTGACTCGACATCGAC
TggcaacgctgcagctgctcccATTGTGTCGCGGATTGATCGCCACGTCAATTTCACGTGGAATACAGGTCCTGCATTCCCTGGAGCTCAGAGTCATTTC
TCGATTCGGTGGAGTGGCTGGCTTAAGCCTCTAGCCACAGGCACAACTATGCTCGGAGTGTCAGTAGTTGGCCATGTGCGCTTATGGGTCGACGATGTGC
TAGTCATTGATCGTTGGGGTGCCGGAGGTGAAGCAAGTGACGGTTTCCCTGCAATCAGAGCAGTGGCAGGCGTAACTTTGGATGTTTCGAAATTGTATTC
TTTGGTTCTCGAGTATCGAGCACCACGTCAGGGAGACATTTACGTTCGATTGTTATGGGGAAGTGTTGGAAGCGCGAAGATGGATGTTATCCCTAACCAA
CAGCTCTTTTCAGGGAGTCACATTCAGAAATCTCCATTTACAAACGTGATTGTGACACCATCGTTGACGGCGAGCTCAGCACTGTTAACCTCCACTCTCC
TGAATGATAAACCGCTCGTATCCCCCGCGCTACGGGTGGTTGCTGGTGAAACACTTGCTTTCAGTGTCTTGCCGCGTGACGTTTACGGTAATCGACGACG
GTCACGAGATCAACACACTCATCTCGACGACATTGCTGTTAGACTTACTTTGGGAACAGATCGGAGTCTTGGAGGACAAAGTACAAAAACGGAGGACGCA
TTTGTATCTTGGAACGGAGAATTAGACGTATTTCGCGTACTGGCAAGACCGCAGCGAAGTGGTGACTATTCTATGAGCGTGAACATCAATAACGTTGCGT
CGGGGGCAGGTCCATTCGCTGTAGTTGTCGTGCCAGCCAAGCTTAATGCAGCAAAATGCGTGCTTTCTGGGTCCGGTCTACTACCTGGTCGCGCTGCTGG
GCAAGCTGTTACTGTGACGCTTGAAACTCGCGATTTGTACGGAAATCGCATCTACACTGGGGGGCTGATCGATCTTAAGCTTCAGGCTTCTCTCTCATCC
AGCGTTGTTCCAATCGTAGTAGTGGGCTCAATCGTCGACAACGCTGATGGAACGTACCAGTTCACGTACACCGCTCGAGTGGTTGGGAGCTACAGTGTCG
CTGTCACGTCGAAAGGCGTTCATTTGCACAATAGTCCGTACGTGGTTACTGTTGTGCCCAGTACTCCGGTTGGACCGACAAGTGTCGCCCAAGGTCCAGG
TATATCTTCTGCGAAAACCAATGTCCAAACAACTTTCGAAGTGACAGCTCGGGATTCCTCTGGTAACGACGTGGCCGCTGGTGGAGTTGCATCAGCACTT
ACTGTGATACTCAAGCACCCTGAGAAGGGTATTGTGAACGGGAATTCTTGCACCGACTTGTTGAATGGGCATTACACGTGCACTTACACAGCACGTTACG
TTGGCCCCACACATCTACACGTGACGTTATCCCAGCAAGAGATAGGTGGAAGCCCATTCTTAGTAGATGTTACGGCCGGGCCAGCTCTTGGATCTCGATG
CATGGCGGCAGGTGGTGCGTTGGTTTCGGCGGTGGCTGGACAGAGAACAAGTTTCACTGTGAGCATTTACGATGCCTTCGGAAACGCGAAAACTAACGCT
GGTAGTGAAAGCGTCAGCGCCATGTTTACCGGTCCAGGAGCAGTTGCAACTGCAGTGAATGCCGCAGTAGCAGTGACATATAATGATCGTGGAGTTTTCC
TTGTAGCGTACACGCTAAGCTTGAAAGGAAGCTACAAGATCAGTGTGACCGTGGACAATGTGGCAGTTGGTTCGAGCCCGTTTACTTTGTACGTGTATCC
AGCGTTGGCATCCCCGACAACGTCGTCGTTGGATTTAATCACCCCAGCAATGCCAAGAACTCAAGGTGACCCACCAGTGGTATTTACGGCAGGCGCACTC
ATTGTGGCAAAGCTCACCACTCGAGACACCTTCGGAAATGTGCTCGAGACTGGGGGCAATCTGTTCCAacttgacgacgctgtgcgTGCATTTCTCGAGG
TGCCAATTGCCGACGGGAGCGATGGGACCTATTTGGTCACATTACGACCAAAACGCAGTGTACGCTTCCCATTTACACCAAAGCTGATGATGCCTGGCGG
TTTAAATGGCTCTTACTACTCTACAAATGCAGTTCCAGTAGGGATAGCCACTGCTGAAGCATCATCCGATCAATCGCTGTTAGTGTTAAAGCGGCGTGAC
CCAACTATTAATTTCGATTTCGGAGAACGCCCACCTTCACACACGTATTCTGCTGAAACATTTAGTGTGCGCTGGGGTGGATTCTTGCTGCCTCGTTTCA
GTGAAATCTACAATTTTGAAGTCAACGTATTGGGCTTTGCCAGTCTGCGGATCGGCAGTGATTCAGTTGCGGTCTACGAAGGTGAAACGAGTTCTTCTAT
GATGGTTCCTCTCAAAGCGCAAGCGTTTGTGGATCTGGAActcaacttctccaagtacCGAGAGATACCCAGCGCCTCTGTAACTCTTACGTGGAGTAGC
CCCTCACAAACTCGTGAAATAATCCCATCATCTCAGCTCTTTACGTCTTGGAGAATTGTAAACAACGTCCCGCCACTCGACATCAAGCCTGCCACTGCAG
ACCCCACAATGTTCACTCCAGAATTTGGTAGTTCTCTAGATCCTGGATCGACGGCGGTACGTGCTGTGGTTGACAAGTCTCTAATCTTCTCCGTTGTGGC
ACGTGATagcttcagcaacaagctTAGCGGCGAAGATTTGTGCTCCTTATACGTACTGCTTCCCCAGGCTCCAAGTGGGAGTGCCCAGCCCGGCGTAACC
ATCACTGACATGCTTGACGGCTCGTACAAGGTCAACCTGGTTCCTCATCTCACTGGCATTTTCTCCTTATATATCGCTGCGCTTCCCGACGTGATGAAGG
CTGGCGCTCCGCCTGGAGGTGACGCGTTGGTGGCTTTCTTAGCCCAATACAACGTCAAGGGTAGTCCATTCAAACTCCAAGTTGACCCTGGACTGCCAAG
CGCAGTAACTTCCACATTGGTAGGGGGCGGCTTTGTGTCCACAACAGCAGGGGTTTCCACTTCcttcgtgctggaacttCGTGATGGCAGTGCTAACCGC
CTCACAGCTTCTATGGTGACGCCGTACCTCGCACAAGGACAAGTCCAAGTCAAACTCAGGAGTATCAGTGCAGGTACCGAGGTAACTGCGAAAGTGTTTC
AACTCGGTGGAGGGGATCTGAACTCTTTGTCGGCTCAAGATGTACGTGTTGAGTATACAGTTACTCTTGCTGGTCTGCATGCCGTGCTGCTGAGTGTGGA
TGGGGGTACGTCGTTCAGTCAGAAGACAGCAACACTGCGAATTTATCCCAACGTGGCCACAGCAGTGACGTCCTTCGTTTCACCTGACGGTGCGGGAGTG
GCCCCAACCGGTGCTGGCTTAGGGCCACAGATCAGCACGGCACAGATCTACACGTACCACGTAACTGTTCGGGATGCATTTGGCAATATTCGCGACAGTG
GTGGCGACTTCCTTGTTGCCCGTATTCATGGCCCTGACAGTTCAGGAGGTAAAGTGACCGATCTAGGTAACGGCGACTACGTCGTGCTCTACCGCGTTAT
GCTTCCTGGTGCATACGAGATCGAGACACGAGTTGCCGAACCACAGCACGGGCTGGCAGGATACTACTACGTCGATACGGGATCTCTCCAGCAAAACGCA
GGAAGTGCCGTGCGTACggtcgacgacgtcatcaacTTCGACTGGAGCAAGAATGTCACCATGCGAGGGTATCCGCGTGTTGTTTGGCGAGGTTTCCTTC
GCCCACTTTTTGGGGAAGAGTACACGCTGTGGGTGAACGTCCAAAGCGATGTCGGGGATGCAGCTGGTGTCTACATCGACGGGCAGACCGTGATTGATGG
CCTGAacactgctgcaacttctgGACGCGTGGTGCTTTACGGCGGGCGGCTTCATGCCATCGTTGTCGAGTACCGAAGCGCCTCGTTGCAACCGTATGCT
GGATACCTGTCGTTGTTCTGGAAAAGCGCTCGACAAGTCTCCCAGCTCATTCCAACACAGTCTCTCATAGCTGAGGCCTCCGAAATTCTTCCCCGAACCC
AGCTCATAGCAGT