Description :
From Genome Similarity Track
Location :
Scaffold_8:114447- 115870
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003848Protein of unknown function

Sequence
1423 bases(100 bases per row)
AAACTCTCTGGCGATCCCGAGACGCGCACTTGAAGGACGAGTACGCCGCCATCAAGATCCTGGCTGTGATTCGAGAGCCTACAGCTCAAGACCCGTTCCG
TTCACTAGTTCTGAAGTGGTCGACCAAGAGAATCGGATCTCTCGCACGCATGCGCGACTGTGTGTTCATCGAAGCGAACGGGATCGCGTTCGACTCGAAA
GGCGTCCCATTCGCCTACAACTTGGTGCACTCCATTGACAACATCGCGAGGATACCTGGACTCAAGCACCTTGACGTCGTGCGCGTGAATATCTCGACGT
GTTACATCTCTCGCCGATACAATCAGTCGTCGATCGAAGTCTTTTGCCGCGGGTTCGTTGACCCAGGTGTGAGTTTCACCGAAATCGTCAGCAACACAGT
GTACCCCAACATGGTTCTTACGTTCATTGATGTTGTGGACTGCGCACTTATGAAGAAGCTGGTGTGGCTGATGCACAAGAAGCGGAACCATAGCGGATCC
TCTCATACACTGAAAAGCTCGTCGTCTCGCCCAGCTAATTGCACTATCTGCTCAACAAAATCCAGCGGCATCTGCAACTTGGTTCGTTCGTGGGTTCCGT
GCCAGGCGTGTCAGACCGTCGTGTGCCAGAAGTGCACCGTCGTCAAGAAGCTCCAAGTGGAGGTCAGTCGATCCGAAATGAAAGAGAAAGCCATGACTTT
TTGTCTGCACTGCATGGTCGAAGCGAAAGAAGCATCGACGCGTCAAGTCGCCAGTGAGAGCGTGAATATAGCATAGTAAAAATATCGTGATTCCGAATCA
TGAGACTGCCATTTTGACTAGAAAGATGATGTGGCAAAACAAACAGATAGAGTTGCAAGTTGCCAGCCATTTTCATTGGGAAAAATGGCCGTGAGTGCAA
ATTTAAATTTGGTTATTGATTTGATCAAGAGGCAATTATTGATCTATTGTCAGGCTGACTTCAATTTGCGGTCTTCCTAATTCTGTTGAATTTGGCACAT
TTCAGATTTCAGCACCATACAAGTTGTCATATATATATACCGTATCGCATTAGCGTACGATCTACCATATTTTAGCAATATGTCTCTCATTGAAGCAGAT
ACGAATTGTTTCCCAGAGTTGTTGCACTTGGAACACTGTCGCTACCCTAGGTATTCAAGTTGTTGTTGAAATAGCAACAACTTGAGTGGCCGAGATCGAT
TCTTGTGTGCTCCTCCTTTGATACAAAGTTTGTATCGCTGTCTACATTTCAATTGACACAACTCAAATTTACAGTGTTGAGGCCATCGAGCTTGGAGTTA
CTTTGCAAGCTTATGAAGATGATTATCGTAGCAATGTCGCCAGAGGACTGACCACCCATCTCATTCATGATGCTAGCGCAAATGAGTTCGGGATATGCGG
AGCGAGATATGAGTAGGAAAGAA