Description :
From Genome Similarity Track
Location :
Scaffold_41:1144366- 1145899
Sequence
1533 bases(100 bases per row)
GGCTGCCATGTGCTAAATACCAAGTGGGTCTTTAAGACCAAAGTGGACGCGGAGGGCGCCATCGAGCGACTGAAGGCGCGCCTCGTCGCCTGCGGGAACG
AACAACAATTCGGGATCGACTACAGCGTGACATTCTCTGCTGTCATCGAGATGAGCAGCGTAACGCTGATCTTCGTGCTCGCCAGGAAGTGGCGCGTCCC
CGCAAAGCATGGCGACGTGCCAAACGCCTACGTGAAGGCGGTGAAGGAACCTGAGCTCGACATATACCTGCGCATCCCGCGCGGAATGGTGGTCCCGAAG
GAGCTGAGGTGCTTGCTTGGCGTGTCCAGCGACAACGAGCTGGTACTGGAGTTGAAGAAGACGTTGTACGGCCTCAAGCAAGCCGGACGCCTCTGGAATC
AGCTCCTTCACCAGACGCTAACGGACATCGGCTTCTCGCAGAGCCTTACGGACATGTGCGTTTACTATAGATCCTGCGAAGGCACCCTACTGGTGGTTGG
CGTATATGTCGACGACCTCCTGGTCACGGGCACGCAGCAGAAGGCCGTCGACGCCTTCTTCAGCGAGCTCAGCATGCTCGCGATCAAGGACTTGGGCCCC
GCCAACAAGTTCCTGGGCATTCGCGTGGTATATGACGAGGAGACGGGCTATGATTTGGACCAAGAGCTCGCGATCAAGGAGATGCTGCGCGAGCACGGTA
TGTCGTCCGTGCACGGCGTGCGCACGCCCATTGAGGTGGAGTTCAACGACGTCGACGAGACCGCGGACGTACTACTGCCTCTCACTGGTGGCGACAACGA
GATCACGATCCGCAAGTTTCAATCCCTCGTGGGCAGCCTCATGTGGGTGGCGCGGTGCACGCGCCCCGACATCGCGTACGCAGTCCACAAGGTGTCACGC
CGCACACACAGCCCCACGATGTCGGACTGGAAGCTTGGGAAGCGGATCGCGCGATATCTCGCGGGCTCGATGACCTTGCGGTTGAGCATGAAGGGCAATT
GCCCGTTGGAGGAGCCGCTGAACGTTGTCGCGTACAGCGACGCGGACTTCGCTGCCGACAAGTCCGACAGGAAGTCCGTCACGGGCGGATTGCTCTCTGT
CGACGGGATGCCCGTGTCCTGGGTCTGCCGAAAGCAAACTGGAGTCAGCCTCTCCACCATGGAGGCGGAGTTTACGGCAGCGTCGGTGATGGCCACCGAG
TTGCTGGGGATGCGCGAGTTGCTCAATGAGCCGGGCGTCGCGTTCAACAGCCCGATGTCGTTGCGTGTCGACAATCAGGCTGCGCTCAAGCAGCTCGACG
GCGAAGGATCATCCTCCAAGGCCAAACACATCGACGTCAGAATGAAGTTCGTGAGCTCCTACACGAAGAACGGCGTGCTGAAGCCGGAGTACCTGCAGAG
TGAGGAGATGCTTGCGGACATCCTCACGAAGGCTCTGGAGGCGCCAAGACTAGCGGAGTTGCGGACAGTCGTCGGCCTGCACTAAGGAGTGCAGCAGATC
AACGCTGGCGGCGAGGAGGAGTGTTGAAATTCA