Description :
From Genome Similarity Track
Location :
Scaffold_16:114433- 122430
Transcript NameFunction/comments
Physo_131480reverse transcriptase
Physo_131481pol protein

Sequence
7997 bases(100 bases per row)
CCTGCTTCCTCTATTAAGAAGTGCTGTGTGCCCCGTTACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCTCATCGAGTGAGCCAAGATTGATCGTACGGAGTTTCCCCATATGAACGACTCGCAGTACGAGTCCCTTCGTAAGATGGCAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCAGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACA
ACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACACATCAGGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGTGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCAAGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGGCTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCC
AGGAACCAGGGGAACGCCGGACACCAGCAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATAGGGA
CTTAGACCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCA
ACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTGGGGTCCACATGGACCTCAATGTCAAGTTCGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGTCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGACGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAG
TCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACA
AGGCGGGTGACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCACCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGG
CCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACC
GGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCG
AGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGAGGCAGTCCTGGAGGA
GTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGAATCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCC
AAGGATCCACCGTCCAATCTCCCTCCTGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTC
CCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTG
TGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCGTGGTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACTGATCCCGCGCAAGGACGTG
TTGCTCAACAACATGGCTGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGG
CTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTT
CCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTACGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCAC
CTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAAGAGATCAAGGTCCTGGGCTGCTTCG
TCAGCAGCGCCGGGGTCCGGGTGGACCCAGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCT
CGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGC
CATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGTGCGCGCCAGTCCTGGCATTGCCGGACAAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGT
CTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAA
CTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGAGCTCGACGCCCTTTGTCGTTTATACAGAC
CACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCAGAATACAACTTCCGTGTCGAGTACA
AGCCGGGCAAGTTGAACGTGCTTACCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGCACGACGGATCTGTATGATCGCATC
AGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAATGTG
CAAGGCTGCGCCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAA
GTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGACGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTATGGTGGCGTCAC
ATGTACAAGTGGGTCGCCACCTACGTCCGTTCGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCTGGTCC
CAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCTGTCTGAG
CAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTATATCTTCCGACACCACGGTCTGTCCGAG
ACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCAGCACACAACTGTCGATGTCGACGGCGGACCACC
CGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGGTTGCC
CATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCTCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTA
CGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAAC
TGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAATATAAACAGAATGAGTACTCTGACTGAAATGG
AAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTTCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTG
AAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACG
TGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTAGAAGCGCGGC
GTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGTGCGGCGTACATCGGAGCAGCATACGCAGGGCCCCGTACGAGCCCTGGCCAAA
CTGGACCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGTCATGAAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCG
ACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTACCAGCACGAGCGGCAG
CCTCGCCACCAAGACCGACGCCAAGCGCGATCTCGAAGACGTACACACGGCCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGG
GGACCCAGCATACGGCTGCGCCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGTCACCGCTGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGT
GGAACGAGTCGACCGGGAGCGGCGGCTCCATGGCAAGCTCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAG
CAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCAC
GGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTC
ACGAGTTGAGCGAACTCGATGAGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATGCTCACGAAGTTCTTTGAACTCTTGGTCGGAATACCCTT
TGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACTCAGGATGGAGTCCACC
CTTGTCCTCCGGCTTCTTGCGAAGTGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAG
AGTGGCTCTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGC
ACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATAC
GCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTAGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCG
AGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGTCTTCGCAGCGGCAGCCGCTTTCGA
CGCTTGGGCACGCTCACGACCTTGTGCCAGCGCCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACG
ACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGAACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGT
CGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACC
GGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCA
GGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTAGCCTCCATCAGCGCGG
ACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGAAGGTGATTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCT
TCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGAGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGA
TTTCGACTTTGTGAGTGAAATGTGCGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTACCGGGGTTACATG
AATAGTGACCCTGTCACTATTCAAGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTACGACAC
AAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCC
TTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACAACTGGAGAC