Description :
From Genome Similarity Track
Location :
Scaffold_172:11435- 14438
Sequence
3003 bases(100 bases per row)
TGAACCCGTGTAGAAGCTTTCGACTTACTCAAGAATAAAATTGCCATGGCGCCAATTCTGAGATACTTCGACCCGACCAGAGAAGCCGTGATTATTGTCT
TTTCGAGTGAATGTGCCAGTTCGGCGTCACTGGTAACAGGATTATGAAGGACTGCTCATGCCGGTAACCTTTACAAGCAGAGCACTCAAGGATAACGAAC
TAAATTACAGTACTATAAAGAAAGAGGTGTTGGCCCTATTTGCGTATACTGGAGACCTGCTTCACTATGCTAGTCACTCGGCCCCTCAAAGTCTTGACAA
GACACTCAAAAATACATGGTTAGTAAATTATACCGGCTTGCAGGGAAGCTTGGGAAACTGGGCCGCTCTCTTGTCACTTTGGAGATCGTGAAGTGTAAAA
AAAGGTGAAGACCATGTGCTGGGGGCGTTGGCAGCCAAAATCAACCCTCAAGAGAGCGTGGGCTTGATACTGTCGGCCATTACTCCTAAGAAGCAAGCGA
GGCAGACGATCGACCTACCTACGCCCACTGTGGAATTAGACGAAGAACTGTACGTAATGAGTTTCGATGGGTCAGCCCGTGTCAAGCAAGGAGGTGGGGC
TTGTAGCGCTATCGTTTGGAGACTCCCGACTTGGAATATAGTCGAATCCGGCTCCAAATATCTCGATACATCAACAGTAAATGAGGCGGAATATGAGGGC
ATCTTGCTGGGATTTAGCTTGTTGAAACCTTCGGAGCGGCGACGGTTGATTATCTGTGGAGATTCCAACTTAGTGGTGCGGCAGATGCGAGGGGGGATTG
AGTGTTGGCCTCGGGTCTATCACTGCTACGAGCCCGAGCTTTAAACGAACTCCAATCGTGGTCTTCTCACGGGATCCTGCATGTGAAACGAGATTGGAAC
CAGAGCGCAGATCAGTTGGCTAGTACCGCCTTGCACCAAAATGGGGGGATCAAGTCGGTGCCGAGTGAAGAAAGACCAGGCTTGGAAGCGATCAATCTTC
TACTGGAGCTGCTAATTCCTAAAGACTCGAACCTCCCTACCAAAAAATTATCGGTAATTTGGTCGCGGTCTCCTAATATGATATCCGGAGAGATCATGCA
AGAGGAGGTAGTACAGCGACTCCCCGTGGACCGAATTCAAAAGACGCAAGAAGAGGAGAGCTGGGTATGAGATTTGAAGGCATATTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGAGAATGGAATGACGTGT
CAGTGGAATCCGCTAAAAAGTGCAGCAAGATGTACGGAAATTACGATGCAAGCGAGGAAGGATTGTTGGTATATTGTCCAGACGCTAGAGTTGAGGGAGA
AGACCGTTACATATCGGTCAGACTGGTGGTACCGGATATTATCCAGACCGACTTACTCCACTATTGCCATACGAGTTTAGAAGGAGGTCATCAAGGAATC
GGGCGTACCTACCAATGCATACGACGGTAGTGCCACTGGAAAGGTCTGTTTCGGAGTGTACGTAGATATGTTTGTTCTTGCATGGATTGTGAGACTGGAA
AGGGTGGACCTACCCTATGAGGGAAGAGCCCAGAATATCGAGGAAACTTATCCTTTCCAAGTTATAGCGATGGACCATGTCCCGTCTCTGCCCAAGTAGT
ATAAGGGAAATACGGAACTTTTGATATGTTGATTTATTCACAGGATACGTGATGGCCAAGGCTAGCGCGTCGCGGACAGCTCAGACGGTCGCTGAGGGAT
ATGAAGAGTGTGTTTTCCGTCGTTTTGGGGCTAGCAAGGCGATCCGTCACGATCGAGAACCGGGATTTATGTCGGATTTCTTTCGAGCATTTAACCGTAT
GATGGGTCAACGTCAACAAGCGACAATTGCCAACTGACCGCAAGCTAATGGTACGGTGGAGAGGATGGTCCAGACTCTAACCAGATCTATCAAGTTGTAC
ATTGCGGACGTAGGGAAACGGGACTGGGACGAGTACGCAGAGCGGTTGACGTTTTCGAGAATACCGCACAGGACCGAGTACGAAAAAAAACGCTTTTTGT
TTGGTCCTCAGTTGGGATGCCAGATCTACCCTTGAAGCCACACTACTGATAGTGAACTTCCGACGCCAGGAGTCAGAACCCGGAAGGTGGAAGTACCGCA
TTCAGAGCCAGTACCAGTGAGCAAGAGAAAAGGTGAACGAGAAGCTGCGAGAGGCGAGTCAGATGCGAGTGCAATTGCAGAACGGAGGGGTGGTCGACCA
CAAGATTCGACCGGGAACCCAGTATGACTCTATCTCGATCGAGTAAAAGAAGGATATGCCAGGAAACTGGCTCACCTTTGGCACGGACCTTTCCGTGTTC
TGGAGTTGGTAGGAGACCATGCAGCACGTTTGGAGACCCGGGGAAAGGAATACCGGCTCTTTCAGATTGTACACATATCAAAGCGCAAGCTGGTCAGGAA
ATTCCCTGATCGACCAGACAACGAGCTAGAAGTTGACCAGGCAGATCGGGTTGACTTTGACAGATGCCTTTTGCCGAAGACAGCTGGGTACGAGAATTGG
AAGAGGGTGAATACGAGGTCGAGGAGATCTTGGAGATCCGCACTGGTAAGAAAACACGTTATGGGCGACAGCAACGAGAGTTTCTCGTTCGCTGGAAGGG
GTACAAAGACTCCTACTGGGTGGATGAACTTGATTTGGATTGTGGAGCCTTAATTCGAGAGTTTGAACGCAAGCAGACGAGCCCTAATCGGTTTGGAGTC
ATG