Description :
From Genome Similarity Track
Location :
Scaffold_2:114342- 123317
Transcript NameFunction/comments
Phyci_88959Hypothetical protein
Phyci_88960Hypothetical protein
Phyci_60836Hypothetical protein
Phyci_403832Hypothetical protein
Phyci_403872unnamed protein product
Phyci_88963Hypothetical protein

Sequence
8975 bases(100 bases per row)
ATGCCTTTCGCCAGGTTTTCCGCCTCGACATCTGTATCAACAGCGTCCGACTCTTTGTGGGGAAACGAACAAAAATTTGCATCCGGTAGCCGTCGCTACC
ACCGTTGCCGTTGGCCTCGGCAGTCTCGCGTCTTCCGCGCGCCGCCACAAGCTCGTCGACTCTTTCCGTGCTTGCAGTACCCAGTCTTCGTGGCTGAGCA
GCCGCTGTCGTGCCGATGCCATCCGACGCCCCCAGCATGAGTGACACACGCGCCGCCGCTGAGCCCAGTCTGGACGCCGTCGAGAAGAGCCGAAGCGCTA
GCGACGCGGCCGTCGAGCAGGACGCAGCCGCAGACAAGCAGGAGGGCGCCTCGCTCGAGAGCGTAGAAGCCGAGATCGAGCCGGAAGAGGCGAGTGACGA
GACCGGAACGCTGAAGGAAAAGGCGGAGGCTGTAGAGGCCGCGGGGCAGCACCAAGCGGAGCTGGAGGAGAAGCCGAGAGCTACCAAGACGCAGGACGAA
CCCGAGCTCGAGACGCCTAGTGACGACTCGTGGAAGGAGCAGGAGAAGCAGCAGCTGCAGAAGCGCGCGCTGCCCGCCCGACCTGCTACTGCGAGAAGTG
CCGAGTCCAGCTCAGTCGCGCGCCGCCCGTTTGTCCCGCTGGCGTCCAAGAGCTGGCGAGTGCGCGCCATGGAGTCCAATACGCAGATCACGCGCCTGAT
GAAGGCGGCGTTGCTGCAGACGCTGCTGCACGCCATCCGCACCGGATCGGTGGAGGGCGTGAAGGTCGCGATTGAGCGTGGCGTGCAGGTGCAGTACCTG
GACAACCGCCAGCGCAACCTTGTGATGCTGGCTAGCAAGTGCGACACCGACGCTCGCCTGCACATTGCGATTATCCTGCTGGACGCCGGATGCGATATGA
ACCACAAGGACCAGCTAGGCTGGAGCTGCCTGCACTATGCTTGGTACGTGAGTCGGGAGAACGTGCAACCGGCTTGGTTGGATCGCTACTCCTTTTTACT
AACTATCCATGGGATTTGTTTACTGTGAGCAGCGCCAGCGGAGCTGATGATGTGGCTGCAGAACTTATTCGACGTGGAGCCCGCGTCGAGTTTAACCCGT
ATGGGTACGGCCCCGAAGACTTCAACATCCCCAAGGTGGCTCGTGCGAAAAGTCTGTTGCAGCACACGGAGCAGCTGCAACACGAGCAAAATGTGTGTTC
AGCCTGGGCATTCTTCCGTCGTCAGGCGGAGAAGACTGGCTACGGTGTCAAGTGCAAATCGGTATGCCGGTGGTAAATGGTTGGGACTTATCCAACTATA
ACAGCTCTAACTCTTTCGTTTTGTTGTTTTATATTCCGCTCTAGAACTGCGACCTTGGCAAGCCTCTCAAGATCACATTTCAGGCTCCTCCAGGGCACAG
CCCGCTTGATCGCATTCGCGTGGTCGACATGAACTCTGATGTGGCATTGTGGCTTCAAGTGTCCAAGACCTTTAGCATCCCTCCTGGTGATGTGGGCACG
ATCACGTTGGACGTGGAGACGCTGGACCGACCGTCACTATATCGTATTGTTTACGAGAAATACGAGCCGACGCCAATTCAGCTGCCAGCCTCGGTGGCCG
AAAGTAACTTGTGCGTAAAGAATCTGGACACTGGAACCACAGTGTCGATGGGGAGTGTCAACAACTTGGTTCTGAAAGAGCTTAAGAGCTCACGGTCATC
GAAGAAGTCGAAGAAATTGTCAAGCTCTGCCAGGTAAGCAAATACGTGGACGGTGCTGTTTCTTTATCAACTTGTGCTTACGAATACTATGATTTCTATT
TATCAGACCAGCGCCGAAGTCTGATAAATCTTCAACGGTTGTTCGCAGAGGGTCGACTACGTAGGTCTTAACATTGCTATGCGCTACAAATTGGTGAGCT
GTTGATTGACGATCAAACGGGTGTATTGTGTTATAGTCGAGCTCGGGAAACCACTGAGAGTGTGCGTGAAGCCATGGTGGAGGAAGATGAAGAAGGAGAT
GAGGCTGAGTTTTCAGCTGATGAGACGATTACGACTCAAGAGGTCGCTGAGCACCCAGCAGTCACGAGTATCACGGGTGTGTACAAAATCGTGGCAATGG
GGGTCGTTAGCGTTTCGACACTGAGGACTGCCAAGGCCAACGAGTATGAAGTTTCCATCAGCCGCAAGGGCCCGCTCGGACTGCAGCTGGTACGATGTTG
TGATATTTTTTGTAAGAACCACCTCGATATTCTTACATTCCTGCTTGTATTTGCTTGTTGAATGTAGGCGCCCAAGCTTGACGGCCTGAAGAGATCTCCG
CGTCTCATTGTGCGACGCAGCCATGGCCAAACGGCAGCTGTGAACCCGGGAGACTGCCTTGTTGCTATTGGCAACGCGAATATCGAGCACGCGGGTCTGA
AACACACGTTGTGGGCGCTGAATGATGCGAAACGCCCACTCTTGCTGCGCTTCCGACGTGGCAATGCCAAAGAAAAGAGGAGTCTGTTTAAGGCTGGTCT
GTCCAAGCTCACAGGACCTCGTAGGCAGCCGGTCATTGCCGTGTAAGAATGAGCTCGGATCAGCTTTTTATTTGCTTAGTTTTGATAGGAAGAACAAACC
AAGGATATGAGGTCAAAGCGTGAAGCAGAGAATCAATTGAGTGGTTGAGGCTACCAGCTGACACAAAGTGAACTTGCCCTGCTCATCTACTATCTTTGAC
TAGGTTTTACTTCTTGGCGGGACAAGGTAGCTCGGACTGGGCTACAACATGGGGTGGCCTTTGTCGACGTGACAGTATTTGAACGTCCTGTTCTGGCTGG
CACATCGTCGGCATAACTCGCCAGGCTTGGTAGAAACGTCGATTACGTGCAGTGGATGTGCCTGTTCCAGTGAAATCCATCGCAATTTAGGTTGTTAGCC
GCCGCGTCCCAGTTTTTTTTCTATCGCGAAAAAACTCACCCTGAAGTGCTCAACTAGATCATCAGGATGGATCTCTGTGCGGGTCTCTGTCTCAGGATCA
TACACAATTGCAGGGTCTGCCATATAAAATGTTAGATGTATCCTCCCTTCTCAAGAACAAATATCCTCACCTTGCTTGCCGTCACCACGCCATATATACC
ACGCCTGCGCCTCCCACCATGCTGGTTCCTGGGATCCAGCGTTCTGGTACTGCTCATGTTGCGATACATTTGAGTAAGCAGACCTCGAAATCAGTATCCA
TGCCTAAATTCTGGCCGTGAAAGCATAAAAATCACCTACAGCGATCGCTAGCATGGACCCTGGCCGTAACGAACTCGCCCACGTTTTGACGTGCAACAAG
AAATCCTTCGGAGCTTTATCCGCTGCATATTTCTTTATCAGCAGCCATTCACCGTCTTTTCCGTTCCCACGCCGCCGAAGCCATGGGTTATGCCCATGGA
ACGTCCACGTGTTTGGCAGGATGACCTGGTGTGGCTCGTTCGGGTCCACGCTGACAACGCCGAATGCCCAATGTGGAAATTGCTGTCTCATAGCGCCGGT
TTTGTAGCCTGTGTAGTAGACGAAGATCTTGTGCACGCACGTCATCTGGTTGTGCATGAACTGCGACCACGACTCGGTCGCTCTGGGCTTCTCCTGCTTG
AGCAGTTTGTCCTGGTCGGCTTCAGCTAGGAATTCTCCGGCCGCCTGCTTGGCCATGAGCTCCACGTCGTGTCTGAGCGCCTTGTTGGTCTGTCAACGGG
CCACAGCACACTCATCAGCAACGCAATATACCCGCCTTCAGCTGCAGCCAGGCTGTCAGAACGCAGCAGCACTCACCATCCCCAGCCTACCGAGCGCAAT
GGGCGGCAGGAAGGCCGCGACGTGCAGCTTCAGCTCGTAGTTGAGCTGCTGGATGTTGGTCACTTTCCGGCCCTTGCGCGCTTTGTGCTTCGCTGTCGCA
ACCACTGCGTCCACGACGTCCGATCGGCGTTTCTTCTCGGCGGCGGCCTTGCCGGCCAGGTTCTTCTGGAAGTAGGCGCTCTCCACGCGCAGCATGCAGG
AGCAGACATCGCGGCGGTTGCAACTGCGCGTGTGGCGCACGAGTTTGACGTCGGTGGGCACGATCGGCGCCTTGCTTGGGCTCGCGGCGTCGGCGGCCGC
CGCCTGCTGCTGCTGCGGTGGCGAGTTCATCGGCGTCGCTTTCGCTGTGTACCCATTTCACTGGAGTGTTGCACACCAACCAGCAGATGAGGCCGCGTGA
ATTTGATTCGCCGAAAATACGACCTCGATACCTAAGTGGATACTTACCCGAGTGACTCACTCAGTGAGAGGCTGGCGATGCTGGGGCCACGGTGCGCGCG
GCCTGTGCAGGCGAGCGGGACGCGGCGCTGGCTGGCGGTGGCCGCCAAGGCCAAGGCTGTCAGTCGCGTGCGAGGCACGAGGGACTTGCTGGCTGAGGAC
TCGCAGCAGCACCGTGAGGTGCTCGACGTGCTGCAACGCACAGTCGAGCGCTACGGATTCCGATCGGTGCGTGTCAAGTAATTACTGCGTCGCTAGGTCG
GCGGATTGTCCACTGACGATTTATTGTGTGCAGGTTCAAACGCCGCTGCTGGAATACACGGATTTGTTCTCGCGTTCGCTGGGAGATGGATCGGACATCG
TCATGAAGGTGAGCAGCGCACTGCTGGATGTTGGAGGCGATTGCGTATATTAATGCAACATTGGTTTCTGCTACGCTTGCAACTTTAGGAGATGTACACG
TTCAAGGACAACTCGGGCAAGAGCGTGACGTTGCGGCCTGAAGGAACTGCCGGTGGGGGATGGATGCATTGGGCTCAATTGCTACAACATTGAAGCTGAA
GCTTTTCGTGAATGTGTGCGATACTTGCAGGGATCATGCGGGCGCTTGTGAGCAACAACTTGTTGTTCGCGCTGCCGCAGAAACTCTCGTATTCAGGTAG
CATGTTCCGGTGGGTGGCGACTGCGTTTTTATTTTCTTCTTCCTTGAAGTGGCATCAGCATAAGTTAACTGTTTTATTATCGTTGGGGTGCAGGTACGAA
CGCCCTCAGCGTGGAAGGTACCGGGAGTTTCAGCAATTCGGTGTGTTGCTTGAATAGTTTTCTTTTGCTTAAAGACGTTGGTCTCATGTTTCCCGTTGCG
TGCTTTCCCAGGCGTGGAATTTGTGGGTTCGTCGGGCCCTTCGGTCGATGCAGAGGTATAGCATATGGTGCTTCACCGGTGGGACAGGAATTGCTGTAGT
AGTTAGCTTACATCGCTTCACCTTAACCTTGGTGCAGATCATTGCGATGGCTGCTGACGCCTTAGATACCTTGGGAATCAAGGACAAGGTCATGTTGGAG
TTGAATTCTCTGGGTGACAACGAAAGGTAAAGAGCAAAACTACCCATACGATCCATTAGTTTGCTCATTTGACCGCCACTGATACTTTATGTATCCCTAT
AGCCGCACAAGGTATCGTGCTGCGCTGGAAGCATATTTTTCCAAGTTCAAGGACGAGCTATCGTCGGATAGTATCAACCGGTGCGTCGGTGCTTGATTTG
GAGACGTGATGCATGATCACTGACGGGAACTCGTTTAAAAATTATTAGCCTCGAACGGGGCAGTGTTCTTCGAATTTTAGACTCGAAGAGTGAAGTCGAC
CAGAAAATTATTGTTGAAGCGCCTCAGCTTAGCGACTTTCTCTCTGACGAATCGAAAACGGTAAGGAAGCGATAATTTCTGCTGAGGTGGTTACATTGTC
AAACTGACATGATAGTTGTTTTCAGCGTTTCGATAGCGTGCTAAGCGGTCTGGACGCGCTGGACATTGTCTATCGGCAAAACTCTCGCCTCGTAAGAGGA
CTGGTGCGTTCTTGACCTTGTTAATTAAATCGTGGCTGACGGTTACTGAACAATGTTCATTCTTGACGAACGTATCTATCGGTAGGATTACTACAGCAAC
ACTGTTTTTGAGTTTGTTGAAAATACTTCTAGCACGGAGGAAGCAACAACGGGAGGGATTGCCGTGCTAGCCGGTGGCTGCTATGATGGTCTAGCAGAGT
CATTAGGAGGACCTGCGACAGCTTGTGTGGGCTGGGCTGCTGGTGTCGACCGGCTTAATCTGCTCCGAGAGATGCCAACCGCGACAGCTATCTCGATTGC
GGTACGCAACATGGCCAACACCACGCAGAAACGTTATCTTGCGGCCTGACATTTTTTTTTTCGATTGATTAATGCACCACAGGTCGTCCCTGTTCTTGCA
GGTGATGATTTGAACCGAGTACTACACGAAGCCATGCGGGTTGCCCAGGTAAGCTAAGTGACGATAGTTGTGCCGTTGTTCATCGGCCACCAAATTTACA
CTGATCCTCTTACATCGTTTCGCTGTGTAGACCCTTCGTCAACGTGGCCTGACGGTTCACTTCTGCCATGGTCGCGGAAATATGAAGAAGCAGATGAAGG
TACTCTCGTGGCTCGTGTAACGATGATGGTTCACAATCTTACAAAATGTGGTTTCGCTTGTTGGTGCCGCAGGCTGCCGAACGCTACGGCAGCACCCATG
CTGTCATCCTTGGAGGGGCGGAGCTTGAGCAGCAATGTGTTAAGGTGAAGAACCTCCAGAAGCGAGAGGAGGCTGAGGTGCCGATGACTGAACTGGGCTG
TTTTGAATTTCCCTGAGAATTGTACCACCGTCGAAGGCGTGTGAATCTTCCTGCTCATGCTGGTGTCCAGCTCTAGTCTTTCCCTCACGTTCATAGACAA
CATCAATAGATGAACTGTTCGATGTGCAGCAATAGACTATTGCCAAGAGGCAATGATTTTTTGTGCAGACTCCAACACCTACAGCAGTAGAATCAAAAGT
TGCTTCAACTTGGCCAGCCAATCGGCGTCGTGGCGAAATGTATAAAAAAAACCTTAAGGTTTTTCGCGCCACGATTTGAAAATGCAAACCAGACTTTGAT
ACGATGGAGGAGGCTCCGACTGAGGAGCTCCGCGAGGAAGAGCGCGGGGAGGAGCGGGAGCATGAGCTGGAGCATGAGCAACAGGACCAGCCCATGGAGG
ATGATCTCCACGAAATGGAGTTGTGGTGCTTGATCGTGGGGATGGTTGGGACGGCGTTTCCTGTGATTGTCAAGGGGACCGACCGTGTCTGGGAGCTGCA
GAAGACGATCAAGAACGAGGCTGTGGAGATCTTCGGAGACTTTAACGCCGCTCAGCTGCGAGTGTATCTGGCCAAGAATGACAACGACCAGTGGCTTTCT
GCAGCGGAGGTGAAGGACATTGAGAACGGTGACGCGGGGCCAGCTAGACCCATGCTGGCCAGAGGTCACTTGGCATCGATGAGCCAATTGGCTGGCATTT
TCAGAGACCGCGAAGCCAATGCCGTCCACATCCTGGTCCTAACGCCGTCGAAGCCTTCCGAGGTAGAGGCAGAGCCAGATATCGCTGGTAAAAGAAAACG
GTCAGAGCACTCCATCGGAGACGTCGAGACTATGAGGGTATCTACAGAGGAATTGCGGTTCCTGTTTGATGTGCTGGGTCAGAAATTGGGAATGGAGCAC
AAATTAGTTGCAACACACACTCTGCACGAGTTTTTGAAGGGATTCGGTGGCTTTCCGTCGTCGTATTTCGTGCGGAAGGAAGAGCTTGTGCTGTGGGGAC
TTGTCATGCGGATTCTGTCGAAGCGAGAAAAGCGTATTGTGATTCTGGGATCGGCCGGCGTTGGCAAGTCGTGCTTTCTTATGCTTATTAGTTTTTACTT
GGCTTTTGTTGAGAAGAAGAAAGTTATGGTTGTACGACGCTTGAGAGAGTTTTCGGAAGCGAGTGCAGTGGTCTACCTTGACGGAGGAAATGACTCCTGT
ATCCGAAAGGCAAATCTGACGGCTGCAAAAATCTCATCGCTTCCTGACAGGAAAGAATTTCAAGGTGCTTTGGTACTTGTTGATGGCTATTCCCGACAGG
AAGTAGACCGCCAGTTTGGTTTGCTTCCGTTCCAACTTCTTGCGTCTTCAATGGAAGATGACATCAATATTGACGACTCAGCTAGGGAAATGGTGTTACC
GGGATGGCAATACAGCGACCTGCTGCAATATGCAGAATCAAAACCGGTGGACTGGAAAAGCTCGGCAGGTTTTGGTCAAGAATCCCAGAGAACTATTGCT
GAGCTTGTGGGAGAACAATACTTCTATAGCGGTGGAAGTATCCGCAACTTTCGCACCAATCGCGAAGATGTGAAAAATGGAATCGACAGTATTTGCAGCA
TGGTGATAAACGCTGGGACGGTCGACTTAGAATCTCTAAACCAACCTGGTTCGCGCCTTGGTGAATTTCTTGATCGAATTCAGCGGCACTACGTTATAGA
TGTAAACGACGAAGAACACTACTGGCAGGTACGCCGTTGGCGAATCCAAGTAGACTCTGGGTATGCATTTAAACGTATTGGGCGTTTTATGGACTGGGAA
AAACATTTCGAACTCTACAAGTTTGCTCAAGTGGCTCGAACTGGATTTTGGGGCGCAGCATACGAACAATGCCTCCATAGTGCAGTCCGTCAGGCTACAA
AATGGTATCCTGTCCAACTGGTGAACGTCATTGTCAACTTCGATCCGACTTTTTCGAATCAAAGATATGACCGGATCGAGCTGCGCGACAATTTTGTTCA
GTGCGAAGGTAGAACGGAGGACGAGTGCTATAGACACCTGTCCAAGTTGGCCCCTGGGACCTATTGGCATCCTGACTGTGCCGGCTTCCCTTTAATCGAC
GCAGTAGTTGTGTGCGATGCCGTTCTACGAGGTAGTAGCATGAGGAAAAAGATCGTTGCCTGCATTAGCACTACTGTTGGTGTCAAGAAGGTTTTCAAGC
CAGATCACTGGAGGAAGTTGAACGAGGCACTCAATGAGAATGATAGCATTTCCAGGAGTGTTCCACGCGTGTTTGTGGTGATGGGCCCTGAAGCCAGCAC
GTGCAAACGGATCGCCTTGGTTAATTCCCCGGCCCCGGAAGAGTTCATGGTGTGCTGCTTCGACCCGCTGAAGTT