Description :
From Genome Similarity Track
Location :
Scaffold_584:11434- 15752
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_584-snap-gene-0.7Kinesin family
Pytve_DAOMBR484fgenesh_masked-pve_contig_584-abinit-gene-0.26DEAD/DEAH box RNA helicase
Pytve_DAOMBR484maker-pve_contig_584-snap-gene-0.9DEAD/DEAH box RNA helicase

Sequence
4318 bases(100 bases per row)
GCGTTTCGGGGTTTATCCAGGCGGCGATGGATGGACACAACGTATGTATCTTCGCGTATGGCCCCACTGGTGCAGGGAAAACGTACACAGTAAGCTGCTA
CCTATGCATTTGCCAGCCCGTTTACCTTCACGAACCAGCACGTGTCTCGTAGATGCTGGGAAGCGGAAATGGGCAGAATTCTGGGATCATTCCACGTGCT
ATCGAACAGGTGACCGTCTTGACCTGTCGTGCGCTTCACACTTGCATCATGTGCAGCCTGTGCTGACATGCATACATTCAGATACATTCGTGCGAGAAAT
TTGCCGCCTTGGGTTGGAAGTTTTCACTGGATGTGAGCTTCATCGAGATTCACACTGACATGCTTCGCGATTTGTTGTCATCGAGCTCGGGAAAGAATCA
GCACCGGCTCAAGATTCGCACCGACAAATATGGCAAGAACTATGTGGCTGGGTTGACAGAACTCCACATCGGCGCCTCCACATTCCGTGATCAAGTTGGA
GATATCCTGAAACTGGCCGCGATCAATCGCCGTGCTGGTCGCACCGGGATGGACATGCATCTACCCCGAAGCCATACCATTTTCACGATGAAGATCCGCG
GAACCAGCGACGCACATTGCACAATGTTGGAAGGCAGCATCTATCTGGTTGATCTTGCAGGCAACGTCTGCATGGGCCATACCGACGCCGATGATAGATT
CTTCAGCGAGATCGAGGCCAACAGCAAAAGCCTGCAGGCGTTGGTTGACGTGTTCAAGGCGATGGAGAAGAAGAAAACGGACGTGCCGTACCGCAAAAGC
AACCTCACGCAAGTGCTGCAACCGGCGTTGTCGTGCAGCCCAAAAGTTCTGATGGTGGCGAACGTATCGCCATCGCGTACGCTGCTCGACGAGTGTGTGT
GTGCGATGCGGTTCGCGCAGGACATGCAAAAGATCCAGTTGGGTAGAGCTGTCCGCCAGATCAAATCGACCTTATCGTCTGAAGACGAAGGACCCCGCGC
ACGACACAAGCTGTCTCGTTCCTGATCTGCGGTGGTTCGAGCTGCAGGAGCAGAGATCCGCATCCCAGAAGCGAAATGCGCAGTCTTACGTCTCACCAGC
GGTGATAGGCCACCCCGAGAGCAACTGATCCGAGAAGTAGTTTGCTCACTGCATTGCTAAATGGCAGACCCAATGCCATTTTGCCTTCACAGTCGTTGGT
GGCTGTTCAGGTGGCCATGCAACTGTTTCGCATGTCGAATCGCTCACTGGGAATCATGGTAGCTCTTTCGCTCGATAAAGCAAGGAGATATGCTGAATTG
CTCTGTTCTTGCAATTGCGAATAGCTTGATCAAGTGTAACCATTCCGTTTTGACATAATTTTATCTTTCTGCCACAATCACTCATCGCGTGTTGCTATCT
TCAAACACCAGGAACAATGGCGGGCGACGATGACGCGCTCGCAGCCAAGTTCGCGCTCGTGGACGCGAGCTTCTGCTTCCTGGCGCGGCACCGGGCCGTG
CTCTCCGTGCGCAACGTGCTGCGCACCGCCAACAGCTTCGGCGTGGGTGCCATTTCGGCCGCCGAGCTGCGCGCCATGGCGGCGCTGGCACCGGCGCTGC
TGACGATCGAGGCGTCGACCGGCCATGAGCTGCAGCACAAAGGCAAGACCCCGTGGCTTTACATGTTTTAGATAGATCCGTCCGAGTGTTTAATGTGCTT
TTTGCGCAGACGATGTGTTCCGAGCGGCGGCGGTCGAGCAGGACGAGAAGGATATCGTGGCGTTCCCGTCGGTGCCGCAGCTCTCGCAGCGCGCGAGTAC
CAAGCGCAAGCAGCTCTTCCAGGCGGCCATTGACAGCGCATCAGCAACCAGTCTAGCTGGAGAATCACAGTCCGCAGCCGTTCCTGTTAAAGAGGCTACA
CCTTCAACACCGGGAAACGCGACGCGATCACTCGAGGATGCATCGGCAAACGGCTCTGCTAATGTGGTCGGCATGCTGCGCCAGCTCGACATCTACCGCG
GCCAAATCGTCCATGTGGAGCGACTTCCTGCTCGCGAGGCGCAGTGCCGCGAGCTGAACGATCTGCCCGAGCTTGACGAGCGCGTTGTGGCTGCTGTTCT
CACAGCAGGCGTCTCGAGCCTGTACTCGCACCAGTTTGACGCCATTCGCGCTGTGCTCGACGGCCAAAACGTTGTCCTGTCAACTTCAACGGCGAGTGGC
AAGTCGCTCGCCTACAATATCCCCATGGGTGACATGCTTGTCCGAGATCCCCAGGCGACGTTCTTGTACCTCTTCCCCACTAAGGTCACGTACTACCAAT
TGCCGAAGTGCGCTTGCTTCGGTTTTGCTTCACACGTCTCGTTGCTGACTGGTGATGGGACTGTGTGCAGGCACTAGCACAGGACCAACTGAAGTCGCTG
CGCCGCTTTTTGAGTGCTGCCGGCCTGTCGCCTGCGCTCGGCAATACATTTGTGAGTTTATCGAAGGGAAAACTTGATCATTGCACTCTCCCTGACATTT
ATTTGCCGCTTTTGCGCATATTCATAGGATGGCGACACTGCAATGGAGGGCCGGTCGATGGTCATTAAAGATACGAGCGTGTTCCTGACGAACCCGGATA
TGCTCCACTTGACCATCCTCCCGCAGCACACTCGTTGGCGGCGCGTGCTGTCAAATTTGAAGTACGGGATTTGGTAGAGCTGGCAATGGTCACGAAAAGC
TGTGGGAATCTCATGAGTTTCTTGTCGAGCAGGCTGATCGTGGTAGATGAAGCCCACATGTATCGCGGCGTGTTCGGCTCGCACGTCGCGTGCGTCTTTC
GCCGACTGTTTCGACTCTGCGCGCTCCACGGGTCCAACCCTCAAGTGGTGTGTTGCTCGGCTACAATACAGAACCCGGCGGAGCATTTCCGCCTTCTTCT
GCCTCTCCTACCACCTGAAGCGACAGTGTCGTCTGTCGAGAATCAAGGCGCTCGACATGGAGACGATGCAGCTGAGATTGTTGACCCGCTTCCGCCAAAT
TTGCACTTTTTCCGCGCTCGAAAGCTCAAAGTCATCACCTCTGATGGTGCGCCGCGCGGCGAAAAGCTGTTCTGCATGTGGAACCCGAAAGCTCCACCTG
CTGTCAATAACCAAGCACTCTCGCCTGCATCGCCTGCATCAGCAACAGCCAAATCATCCAGAAAGAAGAGAAAGCTCAGTCAGCCAGACTCTCGAGCAAG
CGCCAACCAATCGACATCAGCTCCTACCGGTCAGAATGAGCAGGTGTCGACTGATGCTGACGCGATTGTAAGCACAAGTTCGATATTCCAGAGCGCGACA
ATCTTTGCTCGTCTGATGGAAGCGCAAGTGCACACGCTACTGTTTTGTCGCGGGAGGAAACTGTCTGAGCTGGTGCTTATGAACGTCCACTCCATCCTAC
GAGAGACCAGAGATGAGTCAGTATCTCGTCGACTGCTGAAGAAGATCAGCACTTATCGCGGTGGGTATACGATCGAGGATCGGCGCGCGATTGAGCGACG
CCTCTTCAGCGGCGAGCTGCTTGGTGTGGTGGCGACGAATGCGCTCGAGCTCGGCATCGATATTGGCGAACTCGACTGCACGATGCACCTCGGTCTTCCA
TCCAGCATTGCATCGTTGTGGCAGCAAGCCGGACGAGCCGGACGACAGCACACCCAGCAGTCGATAGCGATCATAGTGTGCTTCGACGCGCCATTGGACC
AGCATTTTGCTCGCCATGCACCAGAGCTCTTCCAGCTGAAGCCCGAAGCTGTGACGCTGAACCCGCAAAACGTGCGAATCTTGAGCCAGCACCTTGTCTG
CGCTGCCCGCGAATCGCCGCTGTACTCTTCACAAACCAGTCTTCGGCATATTGACACGTACGTGTTCGGACCATTGGACGATGACATTCTCGACTCTGCG
CTGTGTTCGCTCCTTGGTGAACACAAACTGATACGGTGGTCAGAGGGTGGTGGTGGGTGGAGCTATCGTCTCCATTCCTGCGTTCCGAAGAAGGCGAAGG
CCGTCAATCTGCGCAGCATCAACGAGATCACTTATACGGTACGGCTATTGGCCACTGTGGGCCATGTCTCTTTCGATTTCGCTAACTCTTTCGCGTTGCA
GGTTGTGACGGACAGCGACGAAATGGCCGTTTTGGACAGCATTCCTGGCGAACGAGTCTTCTTCCAGGTCTATCCAACTGCCGTCTACCTCCACCAGGCG
CAAGAGTACCTGATCACCCGCGTTGATAACGACAAGCACGTCGTGTATGCCAAGAAATGTCCCGAGCCACTGACGTACTTCACCACCTGCCGCGACTACA
CGGATGTCGACGTCGTAC