Description :
From Genome Similarity Track
Location :
Scaffold_391:11433- 12563
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_391-snap-gene-0.6TPR repeat-containing protein

Sequence
1130 bases(100 bases per row)
ACAGCCAGGCGGAGGTCATGTCCGTCTGCGTATCGTACTCGACTTTCCCGTTCATCACGAGCTACGCGCGCAGTCTACTCGGCATGTACGACGGCGACGG
CGCGAAGAACGACGTGCTCGCGTCGATCTGCAGTGCCGACCGCGACCTGTTCCTCTACAACACTGCACGGCACTTTTGGAAAGTGAGCTACTGGGTCTTC
CAGCACATCTGCACGCTCGCAGCTCGCTCGAGCGCGTCGTACTTGATCCTGGACATGCACGAGTCGAATCTGTGGATGATCCTCGACGTGCACGTGCGCA
TGATTGAAGAGTGGAGTCAGGAGACGAAGAGCTCTGCGTCCAGTGGTGGGGACAACCAGATCGGATACGACGGGGGTAACGGAGCTGGACTGAGTGTCGA
TTGCTCGTCGTCGACTGCTGCTGCAACGTCCAACCTGCGGGAGAAGATCGGGAGCTACGTTGTCGACGTTGCCTGCTTCTTTGCACACGCGTTGTTCCTC
TCCGGGCGTCATCGTGGGGCGTGGAATGCTGCAAATAAATCGCTGCACATCGCGAAGCACCACAAGGATACGCGGAGCGAAGCCAACACGCGCAAGCTCA
TGGGCATCCTGCTGACCACGGAGACGAAGTTTGACGAAGCAAAGGCGCAGTTTGGCATGTCGCTGATCCTGTACAAGGCAGTTGGCGACAAGATCGGCCA
GGCCGCGTCGCTGAGTGCGATCGGGATGATCCACACACGGAAAGGGAACCTCCGCGGCGCGCACAACTGCTTCACGAAGGCGCTCACACTGTACGAGTGG
TTCAAGCACTCGCTGGGCCAGCTCAACTGTCACCAGCGGCTTGCCAACCTGGAGAAGAAGCTGCGCGACGGCGACGGTCTCTCTCGCAAGAACGGGCAGA
ACTCGGGTTACAGCCACCACTACGCTGCGACGCGTCGACTTCAGGGTGATCTCAATCGCAAACGCAATGGCGAGTACATTGTGCGATGGGTGGGACACGA
GATGAGTCTGCTTCTGGAACTGCCGCTCTCCACTCCCAACAAGCTGCAGGAAGCTCATGATCCGTCGACCGCGTCACTGAGCAGCAGCAACTCTTCTGGA
CTGGGGAGTCCTCATCACGCTGTTGCTGCT