Description :
From Genome Similarity Track
Location :
Scaffold_672:11432- 15362
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_672-fgenesh-gene-0.1TPR domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_672-fgenesh-gene-0.3DNA repair and recombination protein RAD54

Sequence
3930 bases(100 bases per row)
GCTCGAGGCGCTCAAGCGCGACGCCAACGCGTGCTTCCAGCGCAACGCGTTCGCCGACGCCGTGCAAAAGTACTCGTTCGTGGTCGACTGCTGCCTTGAC
AAGCTTGCGCTCGCTGCGCAGAGTCGTGTTGCGACTGAGAGCGCGCGTGCCGAGCTCAGCGCCGTCGCGGCCATGGAGGTCGCCGTGCGGCTAAACCGCG
CACTCGCGTGCATTGAGCTGCGCGAGTTTGTCGCCGCGGAAGGCGACTGTGGAGCTGTGTTATTGAAGCAACACGGCTGCGTGAAGGCGCTCTATCGTCG
TGCACTCGCCCGCGAACAGCTCGGCAAAAGCACTGTACGTGTATTTAATGGCACTTGTATCCACCCGGTTGCTGACGCTGACTGGCTGTGTAGGAAGCCA
TGAACGACCTCCATGTGCTGCTGAAGCTGGAGCCTGTGAACTCGGCGGCGATCCAACTGCTAGCTGGTCTTCAAGCGAAACAGCAGGACGCTGTTGGTGC
AGATGCACTGGTGGACGAGGTGCGCAGTTGCTCGCTGGTGAACGATACGACCGCCAGTCGCAAGCGCTTGGAGCTCGCGGAAGCCGCCGAGCTGGCGTGG
AAGGTGCTCCAGGAGGAAGAATCGCAGATGCGCCAGGCGTTCAAGGCCAAGAAACCGCCTGTGGTGCCACGCAAGAGCAACAAGTCATCAAAAATTGCGA
TCGTTGCCCCCACGGCACGCCAGACGGACAACCAGCAGGAGCATCAGCAACAGCAGGTGCCTCAGGCGGACGGCAGCGTGTTCAAAAACAACATCAACGA
TCTCTGGGAAGGTTTGGCGCTGGAGGAGCAGAACACGGTCGCCAAAGTCTACCAGAAGCGGCGCTCGAGCGCCAAATCAAAGTTAAGGAGCTCATGCATT
TAATTACGAACGACATACCGTAGCGTAGCTTAGAAATCGTCGTCATCCCAGTCGAACACGGGGACTGCTGGCTGGACTCGAGATCGGCGGAAACGCAGTC
CGCAGCCACCACACTTGTCGCTGTCGAGAGGATTTTCTAACGTGCAACGCGAACAGCTCCATGCATCTTCATATCCTGCTGTCGGTCGGCTTTCAGTTGG
TGGTTCGCTCTCTTTTCTGTCTTCGTCAATAATCGACGAACCAGCGTGTGGCGGCCGTACTTGAGCAGGTGGCTCCAGTCTTGCGATCTTTGCAGGTTTC
ACAGCGTTCAAATTGTCGAAGTCGTCTTCGTCTTCATCCTCTTGGTGGTCGCGCATGCCCTTCAGTCGCTTGAACAGCGTCTTTGGTTGCGAAGGAGCTT
CAACATTCTTCGCACTTAAGGCCTCATCATCGAGCATGAATGAAACCTTTCGCTTCTGAGGCGCAGTGGTGCTCTCTTTCGACTGAGACGAGACTCTGGA
TGACGAACCAGAGGTGCTGCCGGGCTGGAGAGGGGTTTCGACGTCGATGACCTCCACCTCCGATTCGGAATCAGCGAATTCATCGGTGGTCTCGTCGTCG
CTGCGCTTCTTTCTGGTGTCTGAAATGTTCACAATTTCGTCGTCCGAGTCTTCCTCTTCAATCTCCACCTCTACTTCCTCTTCTTCGCTCGAAACTGGAG
AGTCTTCAGACTCTTCGTCGTCGATGATGGTCGGCTTCTTCACCTTCTTGTCCTGTTTCTTCTGCGAGTCGACGTCTTTTTTGGACTTCACCGCCTCCAG
CTTCTCCAGTCGCTTTCGCTTACGCTCCTCGTCTCGCTGGTTCTCCTTTACTTCGTTCTCGGCCTGGTGCTCCTGCAGCAGCTGCCAGTCGATGCGACAG
GTGAACGCAAAACTCACGAGGTCGGCGCGGACCTGCTTCAACGCATTCTGCATCACCTCGTCATCCACCGAGTCGTACGAGCGATGGTGGCCCCAGCTAT
TTAGGTCTTCTTCTTGCGGCATTCCGATCTGCGGATGGTAGTTCTTCTCAGCGAGGCTCTTGGCTTCGTCAGCTTCGCCTGCGTGTTCGTCGCCCGAGGA
TTCTTTCTCGGTCACTGCACTTACGTCACCATCGCTCTCGTCCTCCGTGTCGATGGTGATTACATCGCCACATCCGTCCGTCTTGGCACAGTTCCTCCAC
TTACATCGTTTGCACTTGAGTTGGTCGTGAGTGTCGGACATCGTGTCTTTCTCAAACACAAACAGACGCTTGAGATCCTTGGACGACAGTGAGTTGACTT
CTTCTTTGTCATCGACAATGTTCTGGAGGCCTTCCTTGGAGAGCTGTCGCTGGAAGATCTTCTCCTCCAGAGTACCAGTCGCGAGAAAGCGGTACACATA
GCACATCTTCTTCTGCCCTTCACGCCAGACTCGAGCCGCGGCTTGCTTGTCGGTTGCAGGATTCCAATCTGGGTCAAAGAGCACCAAGCGATTTGCACCA
ATAAGATTCAGACCGCACCCGCCAGCTTTGCTCGAAAGCAGAAACGCGAAAGAGTTGGTCGTCGGGTCATTGAAGACATCCACGAGGTTCTTCCGCTTCT
TCGCCGACGTCGTACCGTCCAAACGAACAAACGGCAATTGGCGTTCTCTGCACAAATCGGAGACGACATCGAGCGTCTGCGTGTAGTTGGAGACGATGAC
GATGCGGTCGGTCGTAGACTTCTTCATCGACAGCATCAATCGATCCAGCAACATCATCTTCCCAGACCACTCCGGATGGCAAGTCCGCTGCGTTGACCCG
CCGCGGCGGTTAAGAGTTGAGCCCGGATCGTCAGCTCGATCTTGCTTCGCATTTGTAAAGAAGCGAGCACAGTTCTCAAATCCTGGTAGCTTGGTGTTGC
TCTTCCCCATTTCGTCGAAGATCAACAGCGGGTGGTTGCAAAGTTTCTTCAGCGCGGTGATCGAAGACAGCACGTTCGCGCTTTGTTTCTTCATCATGTC
CCGGAACGCGCTCGACGTGAGAAAGTGCGTGTAGAGCTGCTCTTGTAACGGAGACAGCGGGCAGCACACAACCTGCATGAGCTTTGGTGGCAGGTGCTTT
GCATTCAGGATATTGCCTCGACGCAGAATAAACTGGTTGACAACTTCGCACAATAAAGCTGAGCAGTTTTGCGCGATGTCACGTTCGCGATCAGACGAGT
CGGGCTCGCGGCCGACAAGGATCGGGCCGAGGTAGTTCTTTCGGAACTCACTGGTTGAGCCGAGGATGTTGGGGTTGGTGAAGTCCACCATGGCGAAGAA
CTCTTCGAGATCATTCTGCATCGGCGTGCCTGACAACAGCACTCGGCGACGACACGCGAGAGATGACAATGCGCGATTGATCTGCGAGTTTGCGTTCTTC
AGTCGATGGGCTTCATCGCAGATCAGCAGGTCGCAGGAGCTCGGCTCGTCGTGGAATCGCTGCGCGTGCATCCGGAAGGTCTCATACGAGATAACCAGCA
CTTGCGGGGAATTGAGACGCGGTCGCTTGCTGCCTTCGATGAACATGCTGATGCCCTTGATCACTGCGTCTCGGTTCGCTTCAAAGAGCGCGACGGTCTT
GATGCGTCCATGGAGCCATTTGATGATCTCATCGTCCCAGTTCTTCACCAGCGACGTCGGACACACGACGATCGCGCGCTTCACCGTCGGTAGTCGGTCG
GCCGCCATGCTCGTCTTGAACAGCGTGTACATGAGCGTGATACTTTGCTGGAAACGAATAACAACAGATAGTGCGTTAATCTCGAGCAAATAAATAGCAC
ACAATCGGAGATATAGGCGTAGGTGCTTACCAGTGTCTTGCCGAGGCCCATGTCGTCTGCGAGGATGCAGCCCATGCCGTCGAAGCCTCGGATCTGCGAG
ACGCAGTCATACATGAACTGCACACCCTCGCGCTGATGCGGACGCAGCCACTTGCCGACGATCTCCGGGACGACGACCTTCCACTCAGGGTCTTCTTCGC
TCTGCCAGAGCACGAGTGGCGGCGGGGCGT