Description :
From Genome Similarity Track
Location :
Scaffold_254:11432- 13195
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_254-fgenesh-gene-0.340 kDa peptidyl-prolyl cis-trans isomerase
Pytiw_DAOMBR242034maker-piw_contig_254-fgenesh-gene-0.1P-type ATPase (P-ATPase) Superfamily

Sequence
1763 bases(100 bases per row)
GACGACGGCGAGCTGCTGAGCGAGCGCACGTCGCTCATGATGACAATCGAATTCGACAAATGCTCGCGCATCAACCATTTTTTTCATGTTCGTATCGATA
CATCCGATATCCCCTTAAAAAAGTATTTCATGTTCGTATCAACAATATCCGATATCCTTTAGAAAGTCCGATATCTTGCACTTGACTTGGTCTTTGTATA
CTTTTGGTGAAGAGGACAAAACGCGACAAGTCACAGCAAAAGCATACAAAGTCCAAGTCAAGTGTGAATATCATTTTTTTCATTTTTTTCTATCGTTATC
GGATTTTCTTGACCACATTTGAAAGTAACCACGTGAGAGATCACCCGGACGACGCCGAGAAGACATGGGCGCGCGGCGGAGCTCTTCGCCGGCGGGTGGT
GCTGGAAGCACCATGCGCACCCGCAAGTCAGATCCTTCGCGCATCAATCATCTCCAGCAGCAGCAGCAGGCGCCACCGCTTCGCGTGATCTCAATCGACC
GCCCCAAGCGCATGAAGCGCGCGCTCGATGCTGCGGTCGAGCAGCCGGTCGACTTGACGCTCCAGCGGTGGCGTACGCACATCTTTGGACGCCAAGCAAC
AGGATCAGCTCGCCATCGTGGGTATGAGGCACCTGCACGCGCACAGGAAGAGGAAGAAGAAGACAGCGATGTCCAATTTGCGAGCAACGTGGTCGTGAGC
GCCAAGTACACGGCAGTGAACTTCTTCCCGCGCGTGCTGCTTGCGCAAGTGAAGCGGCCGTCCAACCTCTACTTCCTCTTCATCGCAGCGCTGCAGACAA
TCAAAGAAGTGAGCAATACGAACGGTGTGCCGACGATCCTGCTGCCGCTCACCTTCGTGTTCATCTGCAGCGCGATCAAAGAGGCGCTAGAAGACCGCGC
GCGTCACCGTGCAGACGCGCTCATGAACAGCAAATCAGTGCTCTGTCTGAGTACCATGGGCGACTGGGAGCTCAAGCAGTGGGGCGAGATTCAAGTGGGC
GATATCGTGAAAGTGCTCAATGACGAAACGGTTCCAGCGGATCTGTTCATGCTGCGCGCAGAAGAACTCGACGATCCGAGCGTGGACACTGCAGTTGCCA
ACAAGCTTCAGCACACCAACGCACAAGAGCTACATTCGACTGGGTCAAGTTATGAGCTGGTCGACCTTTCAAACACTGGCGAACGGGACGACATACCAGC
GCCAGCACTGTCACCGATGCAGCAGCGCTCGGGCGGCAACTTGGCGTACATTGAGACGAAATCGCTTGATGGCGAGACGAATCTGAAGATCCGGACAGCG
ATCCCACTGGTCGCGACGCTGTCGTCGCTGCCATGTGACCTCAATGCGCTGCGTGGCGTGATCGAGTGCGAGCCACCGAACAATCGTATCGCGACGTTCG
ACGGGAGCTTTTCCGTGGCTCTGAATCAAGACCAGGCTGCCGCGCTGGGTCTCCAGGGTGCAGGCGATGGCCAAGGTTTGCCAGCATCAGCAACGGACTT
GGCCAAGACGGGCCATCACTTTCTGCAGCAGCTGATGAGAGCACCAAACGGGTCACTGAGTGTCCGCGTCCCGATCACAGCGAAGCAGATGGTGTTGCGC
AGCTGCGTGCTCCGCAACACGCGAGCGATCATCGGCATTGCGATCTTCACAGGCCACGAGACGAAAGTGTTCTGCAGCAACACGGACCCCGTTGTGAAGA
CGTCGTCCGTGGAGCAGCGCCTCAACTCGCTCATCATTGGCGTGGTCTGCATTCAGCAGCTCG