Description :
From Genome Similarity Track
Location :
Scaffold_1505:1143- 3358
Transcript NameFunction/comments
Phyag_g10818hypothetical protein PHYSODRAFT_346539

Sequence
2215 bases(100 bases per row)
GCCGCACGATGGCGTCCATGGGCGGCCAGCCACAGGCGTGGATCAACCCTCAGAATGTGCCTCAGGGTGAAAGTCTCAAGAAATACGGCCGAGACCTCAC
CGAGATCGCCAAAGCGGGCAATCTGGACCCTGTGATTGGTCGAGAAGATTCGATCCGCAGAGCTACTCAGATTTTATCCCGGCGCACCAAAAATAATCCG
ATTTTAATCGGAGAACCGGGCGTGGGGAAGACAGCGGTCGCTGAGGGGCTTGCGCAACGGATCGCATTGGGAGAAGTGCCCGACAGCTTAAAGGATAAAC
AGGTGGTGGCTCTGGACCTGGCGGCGCTCGTCGCCGGCGCGAAATTCCGCGGAGAATTCGAGGAGAGGCTGAAATCTGTGCTAAAAGATGTGGACGAGAG
TCAGGGAAAAGTTATTCTGTTTATTGATGAGCTCCATACGTTAGTTGGCGCCGGAGGCAATGAAGGATCGACGGATGCGGCTAATATGCTCAAGCCTGCA
CTGGCTAGAGGAGCGCTGCATTGTATGGGGGCTACCACGTTGGACGAGTACAGGAAATATATTGAGAAagatgcagcgctggcgaGAAGATTCCAGCCAG
TGTTGATTTCCGAGCCTAGTGTGGAAGATACAGTCACTATTCTGAGGGGGTTGAAGGAGAAATACGAAGTGCATCATGGCGTAAGAATCGCTGATAGTgc
gttggtggcggcggcggcgctggcgaaCAGGTACTTGACGGAGAGGAAGATGCCGGATAAGGCCATTGATTTGATGGACGAAGCAGCGTCGAgactgcgg
ctgcagcaggagagcAAGCCCGAGCCGATCGAGAAACTCGACAGGGAGATTATCCTGCGTCGGATTGAGATTGAAGCATTGAAGAAAGAAACGGACGCGG
CATCGAAGAAAaggatgaaggcgctggaagaagaagtgaaaAAAGCGTCAGAAGAGCTGAAAGAGCTGATGGATGAGTGGAatgaggagaagcagaagct
ggaggagatgcaggatgcgaagaggaagttggAGGAGGCGCGTCGTGACCTCGTTGCAGTGCAGAACGTGGGCAATTACTCGAAGGCTGGAGAGCTGATG
CACTCTGTCATTCCAAAACTGGAGGCCGAAGTGGCACACGAAgaacaggaggaagaggagttTAAGAAGACCGGAAAGAGCAGAACTTCGCTCGGAGATG
CGGTGACAGCTGACCatgttgctgaagttgtggCCCAGACCACTGGTATTCCTGCGTCGACGCTGATAGAaggcgagaagcagcgtctgctAAAGATGGA
AGACGAAATCAACAAGCATGTGATCGGCCAGGAGGAGGCTGTGAAAGCCGTCAGCAACTGTGTGCGTCTGGCGCGCGCTGGCCTTCACACGCACAACCGT
CCGCTTGGTGTGTTCATGTTCTTGGGTCCTACTGGTGTTGGCAAGACGGAGTTGACGAAGTCTCTGTCGGAATTCCTGTTTCAGACACCACAGGCGCTCA
CACGCATTGACATGTCCGAGTACATGGAGAAATTCAGCGTGAGTCGTCTCGTTGGTGCCCCACCCGGATACATCGGATATGAAGAAGGCGGAACTCTTAC
GGAGGCAGTTCGCCGCCGACCTTACCAGGTCGTCCTGTTCGATGAGTTTGAGAAGGCTCACCGCGATGTAAGCAACATCCTGCTCCAGGTGCTCGACGAA
GGCCGCCTGACGGACTCTCAGGGTCGCCTCGTGGACTTCCGCAACACAGTCATTATCCTCACGAGCAATCTTGGCTCGGATATTCTCGCCGGACTTCCGG
AAGGTGCTCCCAGCTCTGTGGCCGAAGGTGATGTCATGAGTGTAGTGCGCTCCCACTACTCCCCCGAGTTCCTCAACCGTatcgacgagctcgtgctATT
CAGCCGTTTGAAGCGCGAGGATATCCGCTCCATCGTGGACCTACAGCTGCGCCAGGtggatgagctgcttgaggaaAAAGAATTGACCATGAAGGTGGAT
CCGGAAGCCGAGGACTGGCTCGGTGAAGCTGGTTACAGTCCGCTCTACGGCGCGCGTCCGTTGAAACGTCttatccagcagcatgtccTCAACCCAATgg
ccgtgaagctgctggaaggttCTGCCACGCCAGGACAAATCCTGCACGTCAAGGCAAACCCCAAATAtgacgaagaacttgtgAAGAACGCCAAAACTGC
GAAGCCGCTGCTCAT