Description :
From Genome Similarity Track
Location :
Scaffold_155:114256- 116251
Transcript NameFunction/comments
Physo_143878reverse transcriptase

Sequence
1995 bases(100 bases per row)
TGACGATCAGGTCCATTACCACGAGGGCGGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCTTCCTGAAATCGCGATCTCGACGACGGAT
GAAGTGAAGATCGATCATATCAAGGTGGGAGATCTGGAGTTCAACACCCCGGAGGAGATCGATCGGCTGCGAAAAAAGATCTGGCATAGGAATCACTTGC
TGATCGGCAATGGCAATGCACTTCCCCCAGCAGCCCGGGGCGTCACCTGCGACATCGACGTGGGCGACGCGAAGCCGATCGCTCAACGAGTCCGGAAGTT
GCCCCTCAGATCGTGGAGAAGGTGTCCGAGCTGAGCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCGCGGGCCTCGCCGATCGTCG
TGATCACCAAGAAGAACGGCGTGGATATCCGACTATGTATCGACTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGTCCTTGATCAA
CGATCTGCTGGAAGATCTGGACAAGGTACTCAGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCAAGCTCGTGCGATC
TCGGCCTTTATCACCCATCTGGGTCTGTTCGAGCGGAACCGGATGTCGTTGGGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGCGT
TGTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTAACTACGGACTTGATCGAGTCATGAGAACCAGAAGATCCGGGGCGTCCATCAGTGCT
AGGTCGCAGATCGTACATCGATGACATTCTCGTGACGGCCGGATCATGGGATGAGCTGTGTGATCGTGTGGATCACCTGCTGGACGCTTGTGATAAGTGG
AACCTCTCGATCAGTGTCTTGGGGGATGCATAAGGTGGATTATCTGGGACATCGTGTGTCGAACGACGGGCTGGAAGCCAATCCGAAGGATCTCACCGCT
CTGACTGATCTGCTGTTCCCCGGATCGCTCCGATCGATGCAGTCGTTCTTGGGCAGCCTCAATTATTACAGCCGTTTCTTGGAAGATTACGCGATCTACG
CGGCGATCCTGTACGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAACGCCCCGATCTGCGCCAGACCCTAGATCGTCAAGTGCCGAACTTAGTGAC
TACAGACCCAGTGGACCCGGATCGGACTCCATCAGTTCCCGAAGTCGGTGTCGCCGATGAACGCTGGATCCGTGCTCATCGTGCCTTTTCGACCCTGAAG
ATGAAGATCGCGACGACACTGATCCTGCGGCACTTCGATCGCGATCGGACTTCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATCTTGGCTGCATTGA
TGCAGGAACACGACCAGATCTATCATCCCGTTACCTTCGCCAGTCGAACTCTGAAGTCGAATGAATTGAACTACAACGTGGTGGAGAAAGAAGTGCTGGT
GCTGTTACGGATTCTGGACCTGAACTGTAACATGCTGGTTGGACGATCGATCCGGGTCTTGACCCGACACTCGACGTTGGCGTGGCTGTTCCGATCGCCC
GGCCTTCAAGGCCGATTGGGTCAGTGGGCTGCACTCCTATCGCCCTGGACACTGGAGATCATGAAGTGCACCAAGGGAGAGGACGAGATATTGGGGGCGA
TCGCCGCTAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGAAAGATTCAAGCCCCGATCCCGAC
TGTGCGCGTGGATGAAGAGCTGCTGGTGATAAGTTTCGATGGATCCGCCCGCGTCAAGCGAGGCGAGGGCGCGTACAGCGCGATCTTGTGGAAGTTACCC
GAATGGAGTGTAGTGAAGGCACGATCGGGGTATGCTGAAGGGTTGACTGTTAACGAGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCT