Description :
From Genome Similarity Track
Location :
Scaffold_199:114255- 116943
Sequence
2688 bases(100 bases per row)
CAGGCAACGTGAATCCCTGCCTGGCGATCCAAATCCTCTCTAATCACTTGAAAATGTCACTGATTCGGGATAGTGACCCCTTGTTAGGTCCATTCTCTTA
TTTTTGAGAAAGCACTTCACCACATTGCCTTTGCATGACGAATTCCGCTACTGCCGAGCGATCGGCAGGAAGCACCGACGGTTTCAATGCATAGTTGGCC
GTGGTAACGTCTTGCTCACGAATCTTGCTGCCTGGATCGATCAAGCTCTGCGACGTCCATCTCGTTATTGGAGATGCAGTATGCCGAGGAGGCTCGATGG
ACTGCTTGGACGGAGAGCGAGTCAGGGCGTTCGAACTGGCTACACCCGAAGATAACCCTGAAGTCGAGTGTGCCGGCAGGCCTGTTGGCACCGGTGAGGT
TGCCGGTGCGTGCTGAGGCACCGGTGCACGTACCGGTGATGACCACGACACGGACTCGTTGTCCGCAGGGCTGACCGCAGCTTCAGCATCCATGTCGACC
GAAGGAGGTTCTCCCTCACCAAGGGTGGAGCCGCCAGCATCCGTGGGGTGGCCCACGGCGAGAAGTGCCGGAACACGTGGGTGGCGAGCGTTGTTCACGA
GGAACGGCGTCATACCCGTCGAGGAGTGCTCGGTGTCGCTGAGTGCGAACTCGGCTAGCGGTAGGAACGAGCTCCAACTCGTGTACGAAGTCGCGTTGCC
GCGGAGAACGTCTTCAAGGACTCGGTTGACGCGTTCTGTTTGTCCATCCGTCTCCGGATGTGCCGCAGGTCGACATCAGCAATTTGGTTCCCAAGAGCTT
GAAAAGGCGTGACCAGAACGCGGATGTAAACCGCGGGTCGCGGTCGAACACGATAGACTCCGGCCGACCGTGGTGACGAAAACTCACGTCGTCGAAGTGG
GCCGCGGACTCTTCCGCGGTGTTAGAGGCTGCCACCGGAACGAGATGGACCATCTTGCTGAAACGATCGACAAATACAAGTACACCCGTGCGCCCGGTTG
TGTCGGGTGGAAGACCGAAGATGAAGTCCATCGAAATGGAGCGCCAAGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGAGCCTGAGACGTCGGAGGCGG
TTTGACTCGCTGGCAAGTTTCACATGTGCGGACCCACTTGCGTACCCACTTGTACATGCGCGGCCAATAGAAGTCTCGCGACAGAGCCGCGTACGTCTTC
TCGCGACCGAGATGTCCTCCAGTCGGGGCGGCATGGTACTCGTGGATTATGCGCGCACGTAGATTAGCGTCGTTTGAGACGACGACTCGAGGTCCATCGA
ACCTGTCGATGCTGTACTACAGCAGATTGCCGTCCAGTCGATATCGACCGATCTGATTACGCGTGGGCCTTGACAGGCCACTTAGCGTGTCACTACTAGG
AGCACGCAGGTGCTTCATGATAGCACCGTATATAGGGTCATCGTCGTACGCTGTAGCAATCTCGTCGCTCAGCGGGAGCGTGGGCGTGGTCAACGTCAAG
TTGATGCCTGACGAAACGCAGACCGCACATTCGTCGTCGTCCTCATCAGCCACCTGATGTCCTAGCGCTTCACGGGGATCGTAGCCCGGACGCCGATACA
GCGCGTCGGCGAAAATGTTATGCTTGCCCGGTTTGTAGTGAATAACGAAGTTGTACTCGGAGAAGAAGGACAGCCAACAGGCCATCCGTTGCGACAAGTG
AGGGCTCTATTTATCGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCGCAAACGACTGTTCACCAAGCAAGTACACTTTGAATTTGATTAGAGCGTACC
GCATTGCCAGAAGCTCCTTGTCGTGGACTGGGTAATTCTTCTCGGCTGGCTTCAGTTGACGCGACTGATTGCTGTCGAGCTCACGCTCGAGTCTGCCTCA
CTGCTACTTGACGATTCATCACCCTCCTCTAGGCGCGGGAGACCGTACTCTACCGGGCCGGGAACACGCGGGCGCCCCTGCTCAACCGCAGTATCGTTTG
ACAAGAGCCCAATCTGCTCGACTGCCGAATCGTTCGGTGGGAACCTCTGCTCTACCGCCGTCTCGTTGTGTGGGAGCCCCTGCTCGAACACCATCTCGTG
TTGTGGGGGCCCCTACTCGACCACCGTCTTGTACTGTGGGAGCCTCTGCTCGAACACTTCATCATCTACTTCGCGACACCGCGAGGGCAATTCGTTCAAC
AACGTAGCACAAGCCATGCAGAGAGGGTCATCGCTCGCTCTGTGCACTGCCTGCGTCGTTGCTGTTTTGTCCACGACTGTGAGTCTCTCGGCGCCACCAA
GAGGTGTGTGACCACCTCGCTCACGTCAAATCCACGTCGACGCTTGACCGATTGAACCAGCCAGTCAATCTCTGGCTGATATCGCGCAAGCGAAGGAATG
CCCAGGATGCAGTCAAACGCATAGTTCATCTCGATCACCAAGAAGTCGTCCTTGCTACGGAAGCCGTCGAACGTGTACGACAAGGACACGTCACGTCGCG
CAACGCGGCGAGCCTTACCATCTGCGAGTTTGACTTGAATCTCGCCCGGGTCATTCCGGACGCGGACGTTCTTGGGTAGTATCGACAAACACGACGCGCA
AAAGCAGTTGTTAGTCGCTTCCGAGTCAAGGAGCGCGCGCAGTGGTCGCCGGGTACCGGTGACGTGGAGGCTGACGATGATCAGTCTC