Description :
From Genome Similarity Track
Location :
Scaffold_119:11424- 15213
Transcript NameFunction/comments
Hyaar_Emoy2810140PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
3789 bases(100 bases per row)
AAACGGGCCGGCGCGAAAGTGCGTCAGCGACGACGTTAAGTCGTCCTGGCTTATACTCGACGTAGAAGTTATACTCCACAAAGGATGACAGCCACCTCTC
CATCCGCTGCGAGAGGTGTGGACTCTTTACGTCCGTGCGTATAGACGCATGGTTCGTAAGAATAATGCAGGGTCTATCACCTAGCAGATAGACTCTGAAC
TTAGCCAGCGCGTACCTCATGGCAAGGGATTCCTAGTCATGGACGGGGTAGTTGCGTTCAGCTTGTTGCAGCTGGTGTGACTGGTAACAGACGACACGCT
CCACATCGTCTGCATCGTACGGCATTGATGCAAAACCGATTGCAACGTCGCTGGCATCACTGACCACGTGGAATGGCCTGTCTTGGTCTGCGATTGATGA
AACTGGCGAGAGTATCAAGCTTTGCTTGATACCTTCGAACGAGCGCTGGAAATCAGCACTACATGTCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGG
TTAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGACTAAGGAACGTTCGAAGTACTTTCATGTCGATAGGCACCGGCCAGT
CCATGATTGCCTTGATCTTTTTCTGATCGGATCGGACGCCGTGCTTACCCACGATGTATCCAAGAAGTGGTATTTCGCTAGCAGCAAATATACACTTCTT
GAGGTTGGCATACAACTTATGCTCACGCATCAGTGTAAGAACATTTCAGACGTGAAGTCGGTGGACTTTCACATCCGTCTATCCATCCATAGCCCGGCTA
TGGACGAACAAATCATCGAAATAGCTAGGTGCGAACTCTCTTAAGGATCTTAATAGATTCGTTACACATCTGTTGAATGTGGCAGGGACGTTACTTAGCC
CTTGTGTAATTACTAACCACTCCCAAATCACACCGCTTGGGGATCTCACTGCAGTATAGGGAATATCTTTTTCGTGCATAAAGATCTGATAGAAGCCATC
CATCAGATCCATGGATGAAAAGATGGTACTCTCCGCCATACCATCTATGATGACATCTTTCCTTGGTATGGGCGTTTGAGCCGGTACAGTGGAAGAATTC
AACTTGTTGAAGGCATGTAATATCCGCCATCCTCCTGTGGCCTTTCGGGCACAGAAGGTCGGAGAGCTGTGAGGGAAAGTTGATTCCCTCACATGGCCCG
CTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACCTGTTCACGAGGTAGTGGCCATTGCTTCATGACACAGTACTATGAACCTAATTTCAGGTC
GATCTCATGACGAGTACCCTTATCCTTGGGTAGCTCACACGGCACTGTTTCTGGGAACACATCTCTAAATTCCGTCAAATTATCGTAGAGAGGATTTGTC
TTGAGCGATTCCCATGATTGGGATGTATATCGCTCAATCCGAGTCGTCTCATCAATTACAATCTCATCCATTGATAATCTGCTGAGAACCCTTTCGTTCT
CAGCGAATACTATTGCAGAACTAATATCGGTTACGTACTCGTCTTCCGCGAGAGTACGCAATTCTGCTTGACTTTGCCACTTCGCAGATCACGCAAGAAC
CTGTCCTGTTTGAGCGTGGGCAATTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTGCCTATTCTTGAGCTGTCATTGA
CCAGGACATTTGATGTCTCTGTTATCTCCTGGGAACTTATATCCACAGTTGGGTGGGGACTTATTCCCTCACTAGCCTCTTGGGCTAAATGATTACATGA
CACGAGTAGAATTGCTCCCTCGCTACCTTCTGGCGGTGGTTGCGCTACCGTGGCCAGGTCTTCTACGTGCGATTCTACAATCGCACTAGATCATCGTATT
GGCAATCATTGGCAATCGTTTCGTTTTCACTTGGGTGTTGACCGTTTGGAGGACACCCATGCCCCAGTCCACTCGACTTATTCGGGTGGTGGGCCTTCAG
CTCTTCCTGCATTGTTATGCTGTCGTCGGAATCTTGCTCCGCAATATGATGGTTTGCCATATTGTGATCTTCTGCAGTCGTACTAAAGACCGAACCACAC
GAGAGGCTATCGCACTCAGTCATAGTACATCCACATGGTGGTGGATGCTCCAAGATGTTCATCAGATGGACGTCTGGTGAACAAGCGACAGGCATATCGA
CAATTCGTCGATGCCAGCTGACTTGTGGCTCGTAACTTCTGAGCCACAGCAGTCCAATGACAACATCAAATTAGTTATCCAAGTCCAATATGATGAAGTC
ATCATTATCTTGGACTTCCTTCAGTGTATAGGTAATAACCACTACACGTTTTATCACTGTAACGGATGCTCCTGTCGCGAGGCGCACCGTCATCCTCGTT
GGAGGGATCTCGCGCTCGATATATTCGAACTCTCTGTTTTCTAGCGATTGGCTCCGTACAAAGTTGTTCGACACCCCACAATCGACTAGGGCTCGAAGCG
ACATATTTTGTGTCACTTTGGGTTTCAAGGTAATAAGGGAAACCTCATTACCAGAAGCAGAAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAA
GAGGCCTGCAAACTCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTTTTGGCTTTCCGTTATGTTGTTGCGTCTTCG
CAACAACGTCGGACCCACGCCTTGGACCTCGCTTGGCCGCTTGGCGGTTATTGTTCCTGCGGTACGTGATACCGCGTTCGGAGCACTGCAATTCGTATGC
ATAATGCCCCGTCTTCTGACATCTATTGCATTTTTGCAATTTCTTGTAGTTGTTAACACAAGAGATCTCGCTCCCCGCGTGACAGAGGTCCTTGGTTCTG
GGCCTCCATTTTCCTGTCGTCTCGACGGACGATTGGAATTCGAATTTGCGTGAGCCTGTTTAACGCTGAAGTCCTCCTGTTCCGCAATCGTTATTGCCTC
TTCCAGGGTGTTGAGTTCCAACCGGAACAGGTGGGTTTTGACAGGACCATCAGTCAGACTCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGA
TCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTATACGTCACGTTTACCTCGCTTGATTCGTAGGAGTTCAGAGCGAGCCCTAA
ATTTGCTCGCGGCGGCTCAAATGTTTGCCCTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCAC
GTCTTTGCACGCCCTGCCAAGTTCGATTGAGCCAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTTATGACATCGTCTAGTTCCACGAACC
ATCTCAACAGAGAGTCTTCATCGGCTCCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGTCGACGTGTACACGTCGACCCGATAGCAGTGGCCTG
CTGCTGTCTCAACAGTTCAAACAGTTGAGCACTATGTTCTCTCAACAGCTCTGTCTGTTGAGAATCTTGTTGGTGAAGCAAGGTTACCTTTTCCCGCTCG
ACGTCAAGTTCATTCTGAATGAACATGGCGATGGCGGCGTGCTGTCCGTCTGGCCCCAGGGAGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTCG
AACTCAAGCGTTCGACGGCATCCCGTTCGATTTGACTCAAATGGGAGTGGTCGTTGACCGGATTACGAAGTGCTACCATGTGTAACGGG