Description :
From Genome Similarity Track
Location :
Scaffold_824:11424- 14072
Transcript NameFunction/comments
g17519.t1hypothetical protein

Sequence
2648 bases(100 bases per row)
GCACTCGCCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGTGGATCTTGACCTTGTAGCTCACCTTGTGTACCCGACGGCT
TGGGCGGGTTGCACTCTTCCGGTACTCACGCGAGGAGTATCAGTGGTGATCGAGATCGGGGTTTGAGCTTGATGGGCTCTTCAGGGGATGGGGGGTTTGA
CAACTACGCGGATATGCTTCACGCAGTCGGTCGGTATCAGGTGTCGATCGTGTGTGGGATCGATCACGGGGGGTTGTTTTCCTTTGCGGGGTCCTTTACG
TTGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGAGACAGAAGGGAGAGCGCGCCTAGCCAAGCGATCTAGGGGCTTCCACGTTTACACTTGATTT
CACTATGTGGGTTGTCGGGTCGTCGGGTAGGCCAATATACTTCCTTCCCCGGAATTCCGCTGGCCACTTGTGTCTTGCAAGGAAAATTCTGGTCTGTTTA
TCCCTTAAGAACTAAGTACCCACTCCCCATCCTGATTCCTATCCTACGATCCACAACCCATCCTATACCTCCTGTGTACCCTTTCAGTGGTACCTTCCCA
AATAATCAGCCGATTTGTACCCATCTCCTCGGCGATCGTCCGAGTGATCGCCTGTACCCATGTCGATCATCTATTCTGTAGCCATGTCCTGTGTGATCGC
GTGTACCCATGTCGATCATTCGATGAAGAGTGATGGTCCCATGTGAAAGTGATGGTCATCCGGATTTTCGGACTTATTGTCCCACGGCCAGATCCACCCA
TCTCCGGTCCCAATCTCATCCTTTCATGATTGATCGGTCGTGACCGCCAAATTGACTGATCGCTTCGCCACAACCGCCCCCTGTGCGAGGAGGGGTCGTA
CAGCGCTCGATCCTCGCATCAGTCCCCAACTTGCCACGCGCCGCTAGTAGCTTACTCACCTGGTCGCTGTCACCCGCCGGCCACGCTCAAGCCCCAATGT
CGTCCCAGGGTCAGCCTCCCACGACGCCTTCCGCCAATTCGGCGTCAAGTGATGCGTCCACTGCATCGGCAACTGCTTCGGGGACGTCTCCAACTCCCAC
ATCGTCGGCTCCTCCTCCTGCCACTGCCCCGCCTACCGACAATCACGCTGCGGTCGGCCCCGAACATGTGACGCCAGGTCCCGAATACTTCTTGCGCCAC
GGGAATCTCCACGGGGCCAGTATATACGCCTCCTCCGCCGCTGCCTCTTCCACGCCGCCACCACCTGGGTCTTCGTCCTCCATCTTCCTATCTCGTCTTC
GTGGGGCCGGCCACAGATGATCCCCTTGCTTAATACTCACTTAATCCACATAAACCCCTTCCACCACCGCGTGCAACCGTCTTGCACCCGTATCCACCTC
TAATCAGCAGCTTTTGCTACTGATTGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGCTAGTGCGATTCCGCTCAAACTCATACAG
CAGCGCCCCACAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTATTCTCGATGGACCCGCCCGTATCTGGTT
TTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTATCTTCTGGTAGAAGTGCTTCATCGAAAT
CAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACTTGGAGACGTGCACGATCGGAAACAGGCG
ATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCACATATGCGCAAGCTTCCGGGCGTAG
CCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCGTTGTGTTGATCGGCTCTAGCTTGTATCG
CGGCCTTGAGACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTCGCGGCTCGTGGTCACACCTCCGCGTACT
GCCGAGCGGCAACGACGCCTCCAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACCGCGCACCCGATCGTGAGCGGTGTTGATC
GCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATCTTCAAGGCGCGAGTGAGTGTCTGCACCATCCTCTCTG
CCGTTCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGCGGAAGAAATCAGACATAAACCCGGGTTC
CCGATCATGGCGGATTGCCTCACTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTCTGTGCGGTCCGCGAAGCACTAGCCTTG
GCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGACGGTATATGGTCCATCGCAATAATCT
GGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCA