Description :
From Genome Similarity Track
Location :
Scaffold_93:11423- 15413
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_93-fgenesh-gene-0.15Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.44Double stranded RNA binding
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.45Mitochondrial protein surfeit 1/SURF1/SHY1

Sequence
3990 bases(100 bases per row)
AACTGTCCAGAAAGGCCTACCTGGTGTGCCAGGACACAGAAGAGCGGGACAAACATGTTGAGCATGAGCTCCATCTTGTACGCCGCATTCCAGAAATGCT
GGGAGCGGGGTGGCGAGAAGCGGTACACGTGGTCAGCCTTCGGAAACACGCCGCCGCCGACCACAAAGTGGCTCCACAAGCGCGAGGAGCTACACTCAAA
AGTCGATGAAAATATCACCTCAGTAACTGTGCATAATGTTGCATACAATGAAAGCCAACGGGGCACTTACATTAGCGCAGGGATGCTCATCCATACGCGC
ACGAGTGGGAGGTAGCACGAGATGAGGAGCATCGGGAGCACGAGATGGATCAGAAAGTCTCCGATGCGTGCGAGAAACCCGAGCGTGGGGGAGCTCGCCC
AGACGCCCAGCCAGCCGTTCAACACCGCTGTGAACGCGTACCGATCAAAGATCCGCAGCGTGTACCATCCGACCATGATAGTGATGCCCATGGACGTCGC
GATGCCACGCGCGGCGTCCGACTCGATCACGAAGTGCGTGAGCGTGGTGAAGAACAGCCAGCACGCCGTGTACATCATACGAACCCGCAGCAGCGGCGGC
ACCACGACGATCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTGCGTCGCGCGCGCCCATCGAGATCGAGCGCAT
CGGGCTCAGCAGCACGTCCATCTTGGCTCCCTCTTTTGTGCTGTGTGGTACTTTCTGTTGTTCAATCGCGACCTCCCCCTCAATTGTAACATTAACATTG
TGGTCATTGAACATGCAACAGAAATATGTGACGTGTGAACGCAGCACAACCTCGAAGCGCTGAAAGCGATGCAGCAGCAGAAACGCACAATGAGTCGCTT
TGAATGCAGTTAGATAGCTAGCAGTTTATGCACTCTTGGTGTACGTGAGACCTGGGATTGGTGTGCGACTGTAGAGAATCACTGGTCGCGACCAGTTCGT
GCGGCCTAACTGGGTCTTGAAGCGGAAGCGGCCGGCGTCGGAGAGGAACGCGTCGATGCGCTCGACGACGTCCTGGCGCACTTGGATCGCTTTAAACGAC
GCAGGGATCTCCATTCGTCTCCGGCTCAGGCGCTTAATCGCATTGCTAATTTGGAGCCAAACAAAGATACAAATTAGTGCAAGTAGGCAACACGAAAGGC
GCTGGATAGAAAAATCAACGTACCGATAACATTTCCAAGGCTGAGGCTCGACGATCAGGTGCTCGGCCATCTCACTGACTTTGTCGAGGAACTTCCAAAG
TCCGTCGTCTCCTTGGTTCAAGTGGATCCACATGGTCACACTGAAGCATGTGATAAGGTCGAATGGACGTTGCGATGGCGAGCGCTTTGCTGGTTCCAGG
AACGAGTGGATCGTGTCGTCAAAGGACTTGTCACTCACATCAGCGTAGCTAAACTGCACCACATCCCCCTCAGTCACCTCTACGGGCTTCTTCACTGCTC
GTTCAATCAGCACTTTGTCGATATCCACACCAAGCACAAAGAGCTTCTTGCGTTCTTTGAGCTCAATGAGCTTCTCTTCTTCTGCCTGTGTTTCCGATTG
TGCTTGTTCTTGGGTCACAGCACTTTTCTCACCGTCTTGGAACGTTGCATCGGCAGCTGAATCCGGCACTTTTTCTTGTCCGCAGCTTTTCAAAACGCGA
AGCGCGACTTCGGCCGCTTTCGCCTTGGCAACTTGCTTCGACACGCCCTCACCTTTGCCCAAGATTACTCCATCAAGCTTGATCTCGCATGCGTAGTGCT
TGCGGAAGTTGGTGCCGCCTTCGTCAGTCACGACGAACTCGACCTGCTTCCGCTGCTTGTGCACCAGCTCGTTCAGGATGCTCATGTTGTTCATGTCGAA
CGAGTTCACGTCCACAAACGGCGTGCTGCTTCTGGCACCGTCCTCAGGCTGTCGGCGTCCATTGAGCGCGTCGTATAGACCAATGGTGAGATCGCCTTCG
TTGCACCCAATGTCAATGACTGTCGTCGTGCTGCTGCTGTGACTCTTGTCGGCATCGCCCAACGCGAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCGTGGGCACATCCATGAAGCGCAGGCGCTCATCCGCCGGGTTGAAGCTGTAGTACGTGTGGAAGTTGCCCAGCACGTGGCCCTCGTGTTGCGTCATCGT
GTTNNNNNNNNNNNNGTGGCCCGGTTGCTTGATCTCGTATCGTATCGGAGCTCTTGGGTGAGTGGCCCAAAACAATACCCCAACTGTATGGTGGTAGTCA
AAATGGTGTCTTTGTTGACTACGAGATAGTCATAATAAAACCAAATCGGACTACCCGATAGTCATAATCAAGAGCTCATCAACACTTTTGAAAGCGTCAA
GATGCTCGCACGTCAATGCCGCAAAGCGCAAGCGCTCGGCGCACGTGTGCTGAAGCAGCAACAGCAACAGCTTCGCTGGGCGTCTTCCGCGGGCGCACCC
TCCTCCGAGACTACTACTGCGGCTGCTGCAGCTGCGAACGCGAGACAAGCGAGTGGTGGTGCATCGAAAGAGAGCAATTTCTCTCGCTATGCCGGCATGG
CGTTTTTCTCCACGATTGTAAGTCTGTGTGTGCATGAAGATGTCTGACTGTACATACTTGCTGTATGATGGCATACATATGCGGGCAAATTGAGCTATAA
CCGTAGTTTGATTGCTAATGGGCGGTATATGCATTTTCGGTGTGAAGGTTGCAGGAACGGCGTACTTGGGAGTGTGGCAGGTGAGTCTGAGATTTCTTTT
GCAAAGGGCATTTATGAAGCAAAAGTAGACACCGAGATGACGGCAAGGAAAGTGTAACAAAGCGATGTTCTGTATTGCTGCAGACGCAACGGTACTATTG
GAAAGTGGATTTGATTGAAGAGCGCAAGCGCGAGCTCCACGAGACTGTCGTGGACTTACCACAGGATGCAACGGCGCGAAGCAATGTGTACGTGTCTTGT
GTTTATTGCAAAGCTCTCTTCTGGAGAGGGTATGCTAAAAGGAAGTCGTCCATTGCATGTAGGGACGATATCGAGTACCGCCAACTTCGTGTCGAGGGCA
AATACAAGCCTGACAGCACCTACTACTTGTGTAAGTACGCCCATTGACGAAGCGTATGACTGTTTGTGGGTGAAATGTTGACTTGCAAACTCTCTCTATA
ACGCTGTAGATCCTCGCTCGGCTCCAGCTGAGTCGACTGATTCGGTTGCGGCTGTCAAGTCTGGCGGATATCTTTACTCGCTCTTGGAGCGAGACAACGG
GTACGAAAATTTTGCTTTGGAGCGGATAGAGTCAATCATTGTAAACGTAACACCTAACATATGCATTGCTTGTGCACAGCACTCCTGTCATTGTGAACCG
AGGATGGTTGCCTCGCAAGTTGCTGGATCAGCACATTGCTAGCAGTCACAAAGAAGGTGACGGCGAGGTGTCCATCGTGGGAGTCCTTCGTCACGGCGAG
GAGGTACTTTGCAGCTGTCTAATAGTTTTGACCCTATTTCTAGTACTTATGTGGTTTACTCACACATTTGCTCCTCACCGACATTAGAAAGGTAAGTTTA
CGCCGGATAATGACGTGAAGAACCGTCAGTTCTTCTACTTGCAGCACGAGGAGCTCGCACGCGCAATGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CCTCCCCGTCATCGTCGATGCGCTCGCGGTTGAAGGAGACACGGCCGAAGCCTCGTTGACGCATCCATTGCGAAAGCGAATTGCGAACTATACCGAGTTC
TACATGTCGCCCGAGAAGCACGCCGGTTACGCAGCTACTTGGTACAGTTTGGATGCGAGGCTTCCCTACTTTCTCTGAGGCCGCTGACGTTCATGCTGTC
TATCTATCGTCCTTTTCTCCACAGGTACTCATTCAGCATTGCTGCTGCCGTGATGGCGTATCTGCGCTTCAAGAAGGGCAAAGTGGCCAC