Description :
From Genome Similarity Track
Location :
Scaffold_63:1142- 2444
Sequence
1302 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnactgttcgttaacgccggtgaccgaatcccagcaactgataatacccatcgaccaagtcgagt
gcactgtacaacgtacatcccaccatgttgttctgcagaacatcctttcgaggaatcggcgtctgcgccggaatggtggctgcattcagcttattaaaag
catgcactatgcgccacttgccattaggctttctgacacagaacgtgggtgtcgagtgcggagacttgctctcacgcaccaagccggctgcgtgcttagc
acggaagaacgcgtcgatgacgtcacattgctcccttggtaagggccactgccgtgttacgcagtatttggttccaggaaccaagtcaatctcatgacgt
acgcctcgatccggaggcaaccctgacggcgggtccttcgacaccacatcgtggtactccttgatcaaaggataaaacggatccgagggatccttgagga
tcgaagatccactcccagcgctcagcgctcgcttcgtgtcctcaaggacagcttcgtccacgacggatgaggagttcaactcctcctcgggtcgtatcat
gaccacctcggcaagctcgccggcctttaaggcctcgccaaactcggcgacggacatctcgtccagctctaacagagcatcaaccgacgggagtcgctcg
agacttatgtctccgtcgacatcccctgtcactccattcacgagtgtgtataactgctcactgcagtcgcgtggagcctcaccgctcaacacgctggaca
cctcgtccgacgtcatagacgtcacagacgctctgcgtctcttcctcctctccctcctcgcccgagcacggccggatgagggctgcagggcgacatcacc
gtcgcgctgcctaggtgccaacgcactatggctcctcggagagggaacagtgtcattcgagacactcagcggcgggtcagcgaccctacgagcaccgctc
aacggagtacgtgccgttccacgtttgtccataggacacagcggcgggtcagtgaccctacaaacaccgctcaacggagtacgtgccgttccacaattgt
cc