Description :
From Genome Similarity Track
Location :
Scaffold_36:1141583- 1148224
Transcript NameFunction/comments
Phyin_T30-4PITG_14727Callose synthase%2C putative

Sequence
6641 bases(100 bases per row)
CGCCGGCGCGCCAGCTCCAATTACTTCGAGCTGGATGCCGATCGGCGCCGCAACAAGTCAGAGCGCTCAGAGCGCTTCAGTAAGCGCATGAACACGATGG
ATGTGACGCCCGCGAGCTTCAAGGGCGCCACACAGGATGACGAGGCGGCCGTAGACTACTGTTGCGAGTTCCTCAAGACTAAGTTCGGGTTCCAAGAGGG
ATCCGTGAGCAACCAGCGCGAGCACGTGCTGCTACTGTTGGCGAATGGCAAGGCGCGTTGTCTGCCGAGCGACCCGGCGGACCATCACCTTGTCCAATTG
GCCAATAAGCTTTTCAGCAACTACCGATCGTGGTGCAAATTTATCCACACGAGTCCGGTGACGTATTCTGGCAGTGGCATTCCGCACTCGACACCGTCTG
GCAATTTGCATATGGACGTGATGCTTTATTTCCTTATTTGGGGTGAAGCGGCAAATGTGCGACACATTCCAGAGTGCGTCTGTTATTTGCATCATCAGAT
GCTGACCCTGGTCAACGCCGACCCACAGGGGCACGAGCAACAACCCGAAGGCTGGTACCTCGATCAGGTGATCCGCCCCATTTGGCGCGAGGCCAGCAAC
ATGAAGCGTCGCAACGCTTTGGGGAAACCCTTGGAGCACGTGAAAATCCGCAACTACGACGACATAAACGAGTATTTCTGGAAGCAACATTGTCTCAGCA
TCCCCGTGGCGCACGTGGGGAAGGAGCTGACGCAAAACCACGGCAAGACGTTTTACGAACACCGCAGTTTCCTCACGCTGATACTGAACTACTACCGTAT
TTTTCAGTTCAACATGATGTTTCTGGTGCTCTTGACGGTTTTGGCATTTGCCGTCACCATCTCCCCAGATGGCGGCAAAAGTGGGTGGGCTCAGTTCGGG
CACATTGGCGACGTCGTGGAGCCATATACCACTCGCGACTTGAAAATTGCCGCTGTTGCCATCCCTTTCAGTCTCAGTCTGATGGCCTTTCTCAAGTGCG
TCATGGAAGTTTGCCACGGTTGGCATTTGCTGATTTCCAAGGAGAGCTCGGCCACCAGCTCGCGCTCTTTCACATACGGGACGGCGTTGGCCACTCGTAT
CCTTTGGAACGGAGGCTTTGCCATCTTGTTTGGCATCACGATCTACGTGCCTCTGAATGAGAACAAAGACACGACGTTGCTGGATAATTTGTACCCATTG
TGTGGCGCGTACATTCTCCCCGGGTTGCTGGTGTTGCTGACGCAAGCCTTTGCACCGCAAGTTATTAATGGCACATTTGCCGCAAAGTTTGTGCGTGAGG
GGGAAAGTTGCTATGTGGGTCAAGACATGACGCCGCCCTTCTCGTTCCGAGTCAAGTACATTGTGTTCTGGCTGCTGCTGTGGGTCGTGGAGGCCATCAC
GTCGTACTTTATCCTGGTGCGTCCGTTGATCCTACCGACGTTGAGTATCTACGACATGACTCTGGACTACCAGAACTCGCTGGTGTCTTTCCACAATATT
GGCATAATCATCGCCCTGTGGCTTCCTGTGGTGTTTATTTTCAACTACGCCACGCAGATTTACTTCACTGTCTTCCAAGCTTTACTCGGTGGCTTCCAGG
GCATCCTCATGAAGACGGGGGAGATCCGTGGAGCGAAGGAGATGACCAAGGCGTTTCGTGTGGCTCCGCAGTTGTTCGACCAGAAGGTGGTCACGCTTCT
TGCGCACTCTAGTGATGCCACAGCTAGCGGTACCGACTCGACACGTGCCAGTGCGCTCGCTGCAGCTTACGAATCGCAGATGATGCTGCGCTTTGTGGTC
GTGTGGAATGAGATCGTCAATTCCTTCCGTGAAGGCGATCTATTGGACGATAAAGAGGCAGCCATTCTGCAGTATGATATCCGTAGCACTGGCGAAGTGT
TTGAGCCTGTATTCCTGTCTGCTGGCAAACTGACAGAGGCGATGGGGCTGGCTATCAAGACGGCAAAAGACGGCAAAGGAGAGTCGCAACTGCGTGTCAC
GCTAGTGGAGAATGACTGTCTGTCAGCCATCCGGTCGTTCTTTACAGCCAGCATGTACGTGATCACTGCGTTGTTCGGCAACGACGACGCCGACGTGGTG
GACGGCTTCCGTATGATGGAGGAGATCGCGTCCAGTGGAGGGTTCCTCAAGTCGTTCAACGTCCGTGAGCTGGCTAGTCTTCGTGTGGCGGCAGTGGATC
TTCTGGAGGAGATTCTGGACTTGCCCGACCCGGACGCGCAGTCGCAACACATTCCCGATGCACGCGTGCACTCGATGGGTGTGATTCGCAACTTTGTAGC
CAAGATGGAGGCGTTTCTCAACGGCGTGCAGTCGTTTTGCGTGGATCCGGCGCTGCAACGCAAATTCAGCAACTCGAAGTTCTGTTCCAGTGCCAATGGC
TACATGTTTGCATCTCGCGGACTCGTCAACTTGTTCTGTAGTGACACGGCCATGGGGGCAGCCACACGCGCGTGTCTGCTGCTGTCGCTGGACCGCTCCG
AGGCCATGCCGCGCACCACCGAGGCGCAGCGTCGTCTGGGATTCTTCATGAAGTCGTTGGTCATGGACATCCCGCAACTGCGCTCTATCAAGGAGATGCG
CAGCTTCTCGGTCGTCACGCCGTTCTACGCCGAGACGGTGTTGTTCTCGCTCAAAGACTTGAACGATCCGCTGGTGAACCACCCGATCTTCCAGCAGGTC
GAGGAGGACGGCAAGAACCTGACGATCCTCAAGTATCTGACTAAAATTCATCAAGAAGAATGGGATAATTTCCTGGAGCGTGTGGACGTGAGCTCGGCCG
AGGAAGCGCAGAAGAACCACCCGGAAGAGATCCGTTTGTGGGCCTCGTATCGCGGCCAGACGTTGGCGCGTACCGTGCAAGGTATGATGATGTACGAGGA
CGCGATCAAGATCTTGCATTGGCTGGAGATCGGCTCGAGTCCAGGCAAGTCGGCGGAGCAGAAGCAGAGCCAGTTGCAAGACATGGTGCGGCTCAAGTTC
TCGTACATCTGTGCGTGTCAAGTATACGGTAAGCACCGCGCAGAGGGCAAAACGCAAGCGGCAGACATCGACTACTTGCTGCGGGAATACCCGAACTTGC
GTGTGGCGTATGTGGACACGGTGGAGCACCAAGACGGCGAGAAATCGTTCGACACGGTGCTGATCAAGAGCGAAGCCGACGAGATCGTCGAAGTGTACCG
CTACTCGCTCCCTGGAGACCCTATCTTGGGAGAAGGCAAGCCGGAGAATCAGAACAACGCCATCCCATTCACACGTGGAGAGTTTGTGCAGACGATCGAT
ATGAACCAGCAACATTACTTTGAAGAGTGTCTGAAGATGCCTCAGCTGCTGTGCACGGCCGACCTGCATCCGTCCAAGAAGCCTGTGTCGATTATCGGCA
TGCGCGAGCACATTTTCACGGGTAATGCCAGCTCTCTGGCCAAGTTCAAGACGTGGCAGGAGCTCGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGA
CCCGCTGTACGTGCGTATGCACTATGGCCACCCGGATGTGTTCGATAAAGTGCTGGCGATCACACGCGGAGGCGTGTCCAAGGCGTCCAAGGGCATCAAC
TTGTCGGAGGACGTGTTCGCTGGGTTCAACTGTACGCTACGAGGCGGCGTGGTCACGCACGTCGAGTTCATGCAGTGTGGTAAAGGCCGCGACGTGGCGT
TGTCCCAGATCTCGATGTTTGAAGGCAAATTGGCCAATGGAGCGGGAGAAACGTCGCTGGCGCGTGAGGCGCATCGCATGGGTCAGTTCATGGACTTTTT
CCGCCTGAACTCCATGTATTACTCGCACACGGGCTTCTACTATGCCACGTGGATGACGATCGTGACGACGTTTGTGTACATGTACTGTAAAGTGTACATT
GCGCTGTCGGGCGTGCAGACGCAGATCGTGTACAACATGAACACGACGCAGGTGATCATGGACAATTCGGAGCTGTACGGCTTCGACGACCGCGTGTACA
AGGACATGGACTCGGTGTACAACACGCAGTACTACATCCAAGCTGGTCTGTTCCTGTCACTGCCGCTGATCTGCGTGTACTTTGCCGAGATGGGGCTGCG
TCGTGGTCTCGTCCAGTTCCTGGAGATGGTGTTTACTGCGGGTCCTGCGTTCTTTATCTTCCAACTGGGCACGACGATGCATTTCTTCGACAATAATTTG
CTGCATGGCGAAGCGCAGTACAAGGCGACTGGACGTGGCTTCAAGATCACGCGCGAGACGTTCGTGTTGCTGTACAAGGCGTACGCGCCGAGTCACTATC
GTAAGGCTATGGAGCTGATCGGTTTGTGTCTCGTGTACTTGGCGTTCGGCACGTTCAACATCTGCGACTTGGACGTCGCCGGAGAAGAGAACTCGTTCGC
GTTTGAGTACTGTCAGACGTCGCAGAGCTTTGGCGTGCAGACGTTTGCGATCTGGGTGATTGCTGTGGTCTGGCTCGTGTCTCCGTACATCTTCAACACG
GACGGACTGGACTGGGAGAAGACGAAAGCGGACGTGACGGCGTGGGCCAAGTGGATGTACGCGGCGGAAGATTACCAGGACGAAGACACGGTGATGGTGG
GCGGCTGGATCGGCTGGTGGAAAGGAGAGCTCAAACTGTACCACAACACGCGGCCGATTGCTCGGTTCACGGTCATTCTGCGCGAGTGTCGTCACTTCTT
GCTCATGTGGTACGTCGTGGCGCTGGAGTGGGAGATCTTGACTGTGGGCTTGGTGTTTGGCGCCGCGGTGGTCACGGTACTCGCCATGGGACTCTTTGGC
GCGGTCGGGAACACGATGCGCTCGGTCAACTCTTCGGTTCGTGCGATCATGTACACGGGCTTAGTGGCGCTAGCGACGATCGTGTTCTTCGTCATGACGG
TCGCTATCTTCGACTTGAGCTTTACACGAACCATCTCGCTGTTCTTCGGATACATGGCAGCGCTGTATGGTATCAACGAGATGGCGCGTATGTACAGCTT
CGCCAACTCGTCGATCGCCACCGTGGGCATGTTCCAGCAGCTGGCGTTCTTCTTCGACTTTGTGTTCTCTGTGGCCATGATCATCCCGTTGCTCGTCATG
TCGGCTATCCCGTTTTTGAACATTATCCAGACGCGTATGATGTACAACAAGGGTTTCTCGGAGGTCGTGTCGGCGTCGTCACAGTACGCGTTCTCGTTGG
CTGCGTTCATGGGCGTGCTGGGAGGTATGGGATGTGGTTGGTTGTTCCACTTGTTCACGACGCTAGAGAGCACAGCGGGCTTCTTGAGTTACGTGACCAC
GTACGATCTCCTGGACGGGAATGTGGGCGATGGATCGGTCACGTACGCCTTCTACTTTGCGTGTATGGTGGGCGCGTTTGTGGCCGGCTTCTTGAACTAC
TTTATCGGCCGTCGCTTGTCGATTGTTCTCGGTGGATTGTTGACGGTTCTGGGTATGCTGGGCGTCAGTGCAGTGCAGTCGGGCGGCGAGGGCTTCTTGA
TGCCTGGTATCTGCTTGCTGGGAGGCTCGGTGGGCGTGCTTCTACCTACGTTAGCCGTGTACATCTACGAGATTTCGACGCGCGATATGCGTGGCAAAGC
GCTGCTTCTACTGGGCAGTGGCTTCATTCTTGGCATCCTATTCGCGGCGTGGTTCTCATCGTCGTCCAATGAAGTGGGCTGGGTGTGGCAAGTGTTCATT
GCGACGATTATCCTGTCGATCATGACGCCCGCCGTCTACATTTTCCCGGAGAGTCCGTACTGGGTGTACATGCGTGAAGGTCTGGAGTCGTGTGAGCGCT
GCTTGGCGGTCTTACGACGCAAAGAGGGCGTGTCCGAGGAGCTGCGTATGATCCGCGACGAAGAAGCGGGTAGTGACGACGCGAGTGCGAGCGGCGGCAC
GTCGTTCCTTAAGTTCGTCATGGGTTTGTTCCTCATGCTGGTGTCCAGTATCTTTCTCGGCTGTGTCAACATGTACCTGTCGGACAAGCTCCGCGGCATT
GAAGACGCGACCTACATGTTCGTCAACTGTATGGGGCTGCAGCTCCTGGGCGCCATGTTTTCGTTCTTCTTCATGGATCGGATCGACCACAAGCGCATCT
TGTTCTGCACCTTGTTGCCGATGGCCGGCCTGGTGTTCGTGCTGGGACTGAACGACAAGTCGGAGTTTGTGACTGGAGACAGCGAGTACTTGATGCTTCA
GATTGTGGGTTTGTTGCTGTATTTCTTTGCGGGTCTCGGCATCACGTCGGTGCCCTGGGTGTCGTGCGTCGGGCTGTTCACGACCAAGCAACGCGCGATC
TACGTGACGGTCTACTTTATGGTGTTCTTCCTGTTGCCTGTGTGTGCCACATATATCCGTTCCAACGAGTCGATGAGTGGCGACGAGTATCTGTACTTGT
TCACGTTAAGTGGCTGCTGTGTGGTGTCCATGGCGCTGCTGTTCACGGTGGGGACACTCAAGAACGGAATGGTGTGCACCAAGGGCGAGATGGAGGCCGA
ACGGGCGCGTATGCGTCGTATCCGCGCGTCTCGTCGCAGTGCTCGCACTCCTGGCAGCGCGCGATCAAGGAACTTCAGTCGCTCGCGAGCAAAGTCGCAC
TCGAACTACCAAATGTTCGAGTCGCCTGCTGGTAGTGCGCC