Description :
From Genome Similarity Track
Location :
scaffold_2:114155- 119124
Sequence
4969 bases(100 bases per row)
GATGATGCGTAGCTCACGCGATTGCGCCATAGTCGTTAGTGTGTCAGACGCTGTTAAGACTCCTTGGACATGTCAATACAGGATTAAATGCGATTGCGGA
TTCAACACCATCCTTGTAAGCTCAAACTTTATATGGAAGGGTCTTAAGCTTGCGTcgtaaattttaattttaagcAAATGTTGAACTCAAACTGTGGCAG
AGGCAGACACAGCAGGAATTTGCATTGATCAAGAACCTTCTAAACAGACGATTTCGGTGATTTTGTCGCACATCTTTAAGAAAACAAAGGAGACAACGAT
CTCATAAATTCTCGGAGCTGGACAACACCCTTGCTGTATGGGTGTTCTAGTGTCACGCACGGCGAGTTTTGATAGACATAAAGACAAGCTAGAGGCAAAT
TTGTAACGGAGTACGTACTGTAGTATTGTGTAGGCACACATTAAACTTCTTTAATTGTACGATGTACAAATGTTCGATCGTAGATACCGAAGTATTAAGA
CCTATGCTCAGGGGTTCGGCATCATGCGATAAGTATATTGTATAACATACTGAGCATAGTAAACAAATTAATTAGGCATTTACAGATATAGACTCAACTG
TATATATAGACTCTACTCTGAATTAAGTAAGAGTTGAGAAGCACAAGTTTGTTTACTTGAAAGGCTCCAGGCTTAGCTCATGGTGGGGTGTACAAACCCA
AGCTCTGTACCTTTTTAGAATACACTTATTGAGACAATTTGCGTCTATGCACAATGAAAGGCAACGCCATTTCACCTGAAACCTCGTTGTAAATATCACC
ACTGAGCCATTAAAATACTGAGAATGGAGAAACCGAGAATGGAGGATGTAATGTCTTTTTATGTAGTCAACCATCCAAACGTGTTGCGTCTATATTGAAT
AATATGGGACCAGGAAATGGTAGCTAAAAGACAAAAGGCACATATTGTTCGTCTGGAGGGCGCTAATCACATTTATAGATGCGCAGGCAAGCGTGTTCAG
GAGCGCAAAAACGAGGCGTCGGCGGTGAGTCTAATGGCTGCCACCATACTaccgctggttctgagcccCTGCCCCGTGGTGTAGAAAGAAGTGTAATCTT
TCTCTGACTCTGGACGAGCGAATCTGAGATGGCCAGAAAAAGTTGGATGAAGGAAGAACAAGTTGCGCTTGCGGTCTCTCAGCTAGGAGGTCTCATTCTT
AAATCAGTACCCACTTGCAGAAACTATATGGAGAAGGCCATATCAATATGCAAAAATTTAAAGCGACATGTTCACGCTACCTGATCAGGTATATAGGATG
CAATCCAAGCTCCTGTCACCGATCCATTGAGTCGGAATTTGATAGACTATTTATGTTTGGGAGATAAGAGCTATTGTCACCGAAATGGTGTCGAACCCTC
ATTCGGAGGCTAAGTAGTCACTATAATCATGGACGTGCTTCGAACAAGTGCGGCTTGCATCAAGACCGTTGGCGTTCGCCTTATTCCCGATAAAGAAATG
GGTGTTGCGTTAAATGCAAAATACAGCTTTTGCGTTGTGGTGGTTAGTCAGGGCACGTGGATGCAACCGCTGTATGAAAAATCTAGAGGCGATGGACCTT
AGTCACACTGACAAATTAGAGAGGTAGCTCCGTGGTACTCACAGATATTGTATTGAAGGTAATACGAAACTTGCTTGCCCCCTTATCGCGCGGCTGGGGT
GTAGGAATGACCAGCATTCCCCGTAGAAATTTTCAGATAACCCCCACAAGGGAATGAGTGGGTTCCCATTAGAAGCTGGGCGGCTCACTAGGACAAAATA
AGATGGGTTATATTGTCTCTCGtggaggtcgtggccaaTGGGACCGAGATCTACGAAAGCAGTTATCTCTAATAAAGACGAAACTCAGAGCTTAGGACAG
CTGGTTTCTGATATCAACATCTCTGGTTATTGCGAAGTTGTGAAATGTCTAGGCAGCATCAGAAGCATTGCGCAAGCGCTTATAGCTCGAGACTGCCAAA
ACTGATAAGCAGAACGCGGAGGCATTGAAGCTGTCATATGCATATGCGACATCCCTGTTTCATCCCGACGGGAACACAGGTAGAAGTATCAAACTTCTTA
CCGAATCTTCAGTTTAAAGCATGTAGCGTTGTCTTGGACCTTTATATGATTAACGAGGACAAACGATCTCATTCTAGGAATGGCGTGGCAACGTCACAAC
ACATAGGTTGGATGAAAGTCGAGGAATATAGTGCAATCATTTTTTGTCTGGCGGAGCTTTGACCAGTCATGAAATTCCAATTACGTTGTAAAGCGTCAag
gtaaaaaaattattagcGTATGATATTTGACGGAATGAAACCTTGTCCTACGATAATTTATTGTTTCAAAATTAACACAATCATAGTCCTTCTCCTGGCA
TAAAATCTGTGttacaataaaaaaatgcaatgtGTAGTTGTTGACTACCTAAATATAATTGCGAGTAGACATATATTTCATTAGTGTAGATGCAAAGCTG
CGATAGATTTCATGTGATACAGGGATGATTTCCACATTGTTCGACAAAGAATACGTTCTGTGCGTTAGCAGCCTCGTGGTTTTAATGTTTCAGCGTGACA
ACCAGTATAGACATTGACAGAAAACGCCAGAAAAATTCACGACTCAAGTGCAAGGTTGGCAGAATGGCAAATAGGTTTGGGGGTCATTCTTAAGAATTTC
TTATAAACTGGTCATCGATGTTTTAGACTTTATTATATCTGCGGTAAATTAGAGTAAAACAGGATCGATAATTTACTTCTATAAGCATAGTTCAGTCCCA
TTACACGCGTTGTGTGAACCACATACTTTTGAGTGTGTGATCAACAAACAATATATGCTGTTTATCCCTCAATTCGGTTTATTACAGTTGAACTAATTTA
TCAGCTtaggaaagctttaaggccTTTTGGTCACAATATATGTCACTTCACATTTCTCTCCTCGATCTTTCAAATCGACGGCTACCTGGAAGCGAGCAGG
ACGCGTTGAAGCGTGTTTACAGATTTAAGTATGTGCACGGGTCATTTcgttacacttggtagcacttgtagacAATCCAACGCCTACTACTTCGGTGGAT
TCATCTATGGATGATTTGAACACTACAGGAGGAGGTCGCCCTCAGATCAACAGGAAAGAATATTTGTTCCTAACACATTTGCATTGGGAGTGTGTGGCGA
AGCTGCGAGTTTTGGTTCAACACCCCTACATGACAAGAGCTGAAGATGCCATAAAATCAATGTTCCTTCCGCCTGATGTGGCCTTTTGACAACAGTTGAA
GTTTTGTTGTGCGGTCAAGACAACAGCACATTCTCCGACTATATACAGAAAGTCCGTGAGCACCGTGCTAGTATGACAAGGGAACCACTGTCAGAGGCAG
AGATGGTCACCTCGTTTATGGAGGGACTTATTTACGGTCTCTTTAAGACTGAAGTCCTCCGTCAGAGTCCGACGACTTCGATAAATGCAATTTTGATTTC
ATTGCGTGAGGACTACTTCCAGCGTCAAGCACGTGGTCAATTGATTAATCCAacagtgcagcggggctgtcgcagctatttgcttagaggaagctaagct
aacgtcaccgaccttacgttttataCTAGAACAATTTGAGTGAAAGGGGTCGCAATCcttacctccaagagtacccagaaCCTTAattcaaggcaaatac
actattCTGCTCAAATTCCGATCTGTattatatttatttatttgcggcgGAGCCGCATATATATAATTCCCAATTAAATAGTacaacctaattaaaatgc
ataatttCTGGTGGTTATGCCGCGTAGTGGTTAGTTGTTAGGGTGTTGCCACACAATTGTATGGTCTCGCCATCTTGTTTGACCCATCCCTTTATACCAT
GATACTTTTAACCCGTTACAGAGAGAAGCAGTGACTACTACTCCTGATAATCTAGAATCAATGTATCTCAGTGCGGTAGCTGTCAATCGGCAGCAAATTC
GCTACTAACAATTTGATCATATTCGCCATGATCGTCCACGTGAGAGACGAACCTTTCAATACGATTCCCGTCCTAATGGTTTCGAGCCACGTGGTACGAA
TATAACGAGTCGATCGGCAAACGCCGGTTCCGAGTAGACGTGGTCTCTTGGTGGTTACAGCGAGTGTGAATGGTAACGATCGTCCGTTTAGAGTCTAAAT
TGACTCTGGCACATCACGTAACTACGCGCGGAATCAAAGTGTTGCTAAAAATATTTAATGCTCTTGGATGCTCTTGATAAAAGAAATGGATTTATCTCAG
TGAAGTTGGCTACTGGTGCGGTGATCAATGTGATGAAAATTATGATTGATCTTTAATTAAAAATTGCCTTCCTTAACTTGAAGGAAGTATTCACATCCTC
GAGATGGACAAACAGTATGGTATGATCTTAGGTATATCGTGTCTTGAAATCATacgccatggattgattggcgaTCAAAAACGATTATGAGTTGCTCTTC
TGGTATAGGCAATGCCTCTGGGTGTAATGATACCAAATACACCACTCAGCAGAAGAAGCGCTAAAGCGCTCGTAAGTCGTATCCTGCTGGAAATGATCCA
CAAGagtaagaaaaaaaagagaGGGAGAGAATAAGCTGCATTGGTATATGTCATGCAATTGTTTTTCCCCAAGATAGGGGGAATAAGGAGGCATATGGAG
TGGCATCGATAGGTCACTcaggaagtgtgtcgatAGATCAAGTGATGCCGGAATTGGCCACATAAAACTGAATGAATCGATGTTGGGCATGGCAATTTAC
CCAACGGCATGAATTTTAGGGAATAGATGCCGGTTGTTGACCCACTCAATACAGAAAAATGTTGTCGATATGTGTTTAATTGAAAGTTTAAAAAAAAGTG
GCTTGATATGCCGATACTCCCATTAATACTGTAGTTGAGTTGAGTCGGATTGTGGTCTGTATGTGCAAC