Description :
From Genome Similarity Track
Location :
Scaffold_19:114111- 117134
Transcript NameFunction/comments
Sapdi_VS20SDRG_06827hypothetical protein
Sapdi_VS20SDRG_06828hypothetical protein

Sequence
3023 bases(100 bases per row)
AACGACTGGGACAAGAACGTCGAGAGCGTCGGTACGTTGCATGGCATGCATCAATTGACCATCACCGCACGACTGTAGCACAAACCTTTGTCGCGCTCTG
CACCGCCGACCCTTTCTGCAGTGCCAAGTTTCCCGGCTCGGGTGCGTCGACCTTTTTAATGTTCCGTGGCTAAGGTCGCGTGCGATTAGATTTGAAGACC
ACGATGACCGCGTTGTACGCCTCCTTGGACGCGGGGCCGACCAAGACACAGTGTGCGTCGCTGCTCTCGTCGGTGCAAGACGGCTTGTCCCCGTCGGACC
TGCTCCGCATTGTCTTTTCGACGCTGCTCCAGGACCAGAGTTTGCGACCGCTCATTCCTGCCCTTGTTTACCGCATCAAGCGGTGCACGACCAATGACGC
GCTCGCCGTGTACAATTTTCTTGTCCAATTCACGAGCTCGTACGACGACAACTTGTCCACATGTGTCTCCACCAATAAGAGCTCATCGCAACCTGGTGTA
TAGAAGCAGCGACGATTCGGATGTGCTCGATTCGACGATGCTGTACAACCTCGTCGTCGCGTCCGAGCTCTGGCGCACGCCGACCGAGAGTGCGTCGGCG
CTCGCGACCACATTCGAATCGACGTTGATTGGTAGCGACGTCTCGGACCTTGCGAAAATGTACTGCATTGCGAGCGGCGGCAGTGACGCCAACTGCGCCG
GCGTCACCGCGTCCAAGTACCGTCTCCAGTACCCAACCGACAAGTACTTTGACCAACCGATTACGATCCCAACCGGCGCGTCCGTGCTCCTCATGGGCGG
TCGCCTTGACCCGCAGACGTACTACAAGTACGGCGAGTACCAATACGACAGCTTTATCGGCACGGCCAAGCGCCTCGTCGAATTCAACTACTCGGCGCAC
GGTACCGTCGCCAACACCCCAGTTACCACCAAGGTAGTCGCCCCAAATCGCTTGCATCTCATGCGTCAGTAGAACGGAGCGCCTTGCGGTGCGCAGATCC
TCGGCTCGTTTGTGCTTGTCAATGGCGACCTCGATAACCTCGACACGTCGTGCATGGCGGTGGTCCAGCCCATGACGTTCCAGCTGACGGCTTCGAACGT
CCAGTCGCTCATGGCGACGACCGATGCGTACGACGGCACGCCGACGCAAAAGTTTACGCAAGGCATTACAAAGACCACCAACCCGAGCGGCGGGTCGTCG
TCCGGGTCTCTCGGTACCAAGACGACGCCTGACGCAACATCGTCCGGGTGGAAGACGGCGGCGATCATCGCGTTCGTGCTTGTCGGGCTCCTCCTGCTCG
TCATCGGCTATCTCCTGTACCGAGCCCGCGTCATAGCGCAGAAACAGCCCACGTACGACCAACACGTTACGGAAGCCTAACCCTGTACAGTGTCAACTCT
GTCGACGCCCTTGCTCGTCGTAGTATACACTGCGTTGTTGACATATCTAAAATACCACTCGACCGCGGAACGAACTATCGTGATGAGCTTGTTGCTTCTT
CATTCCATTCATTAGCTCCAGACGACATCCGAAAGCCTTACGCTTCCGGCGAGTCCAGCGACGTAGGATCGCGGGCAAGGACATAAATGTACGGCCGATG
CACGAGCTGGAGACGGCGGACGTCGATGCGATCAAAGGTCTCGACGACCGCGAGCGTTGAAAAGCCCTACGCGAGCACATTTTAGTTCGCAGCTACCACA
GCGTAGTCGTCGGCGTACCTCGCGCGATGGCGTCTCGGTCACCAAGTAATCAAACGCGCCAAAGTCCGTAATGCCTTCCGTCTTGTGGTACCTAATGGAG
CTCACGTCTACAACGACAGCGACGACGACAAGATCGACATACGTCCACGCGGAATACTGCTCGCCAAAGCGGGAGACGCCCGTCATGGCCGCCGCCACGT
CAATGTGCACGTGCATCGGCTTGGTCGCGCGCATCTGTTGCAGCGCATGGAGCTTTGCAAACGCCACACCGCCTACGCCATTTATCTACGTCTCCAAGTC
CCAACAGAGCTGCGAACCCGGGTAGTTGGCATGCGACGCCAGCGTAAAGACCACCGAGCAGAGCGCCGTGATGACAAGACACAGTGCGACACACAGTAGG
GGCCACGTGGCCTACGCAGCATCACATCGACCATCGAGCCAATCTAAGTTTGCAGTACCTTGTGCCGGCCGCGCCAGAGTTTGGCGACACCCTAAGCTCC
ATGCATACGCCACCATAGACTACGTGCACTCGACGTACGACAGCCGAGGCCATATTGAGCATGGGCACCGCGTTCAGAATGAACCGAAGCTCCTTGTGGG
GCAAGATCGAAAAGAGCAGCACGTACAAAAGCACCTGCACCGCTGCATGATGCGCCCGCCCGAGAAGATTATGATAGCATCTACCGGCAGCACGTAGTAG
ACGACGTCGCGGTCGAACCAGTTGGCCGACATGAGCTGCGTTCGAAGTTGGCCGAGTCGCATCGTCGACACATTTGGGAGGACTGACCCGAGGGACCTAC
GAAGACCGCATTGAGAAATCGTAGCAAGAGAGTGCAATACGTAAGGCCCAGCGGCAGCAAGAGCGCGGACGCCCCAAGGATACGTGGCAGCGCCGATGTC
AAGTACCAATGAAACGGGTGCGTCCCCCACTCGTGGCTCTTGTTGAGGATCGTGTTGAAGTAGAGGACTTCGCCTTCGGGCCAGAGCCAGCGCTGCCAAA
AGACAGAGTCCACGCCGATCGTGAGCGCGATGGCGCCGAGCGCCGACGTCACGCCGACCATGACCATCTCGAGAAACCCGACCTAGAGACATATCCTCGT
CCTGCAGTGTCGTCAAGGACCCATGTACGTGGCGTGCGACGAGGAGCGTGACCAAGATCGGGGCAAAGAGCACGGCCGTGTCGCCGCGGAAGACAATGGT
CGAGACGCTGAGCAGCATAATGACGCGGCGCGACTGGCCCTACGACTGCTTGCTCAAAGGCGCGGGCGGCGCAAGCGCACGTACCTGCAGCCACGCCGCA
TACGCCAGGAAAACCAAGATCTA